ADRM1 (NM_175573) Human Untagged Clone
CAT#: SC320941
ADRM1 (untagged)-Human adhesion regulating molecule 1 (ADRM1), transcript variant 2
CNY 3,656.00
CNY 7,220.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARM-1; ARM1; GP110; PSMD16 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_175573.1
GGAGGAAGAGCGAGCCCGGACGGCGCCTCTCGAACGAGTGTGGGCGCGAGGATGACGACC
TCAGGCGCGCTCTTTCCAAGCCTGGTGCCAGGCTCTCGGGGCGCCTCCAACAAGTACTTG GTGGAGTTTCGGGCGGGAAAGATGTCCCTGAAGGGGACCACCGTGACTCCGGATAAGCGG AAAGGGCTGGTGTACATTCAGCAGACGGACGACTCGCTTATTCACTTCTGCTGGAAGGAC AGGACGTCCGGGAACGTGGAAGACGACTTGATCATCTTCCCTGACGACTGTGAGTTCAAG CGGGTGCCGCAGTGCCCCAGCGGGAGGGTCTACGTGCTGAAGTTCAAGGCAGGGTCCAAG CGGCTTTTCTTCTGGATGCAGGAACCCAAGACAGACCAGGATGAGGAGCATTGCCGGAAA GTCAACGAGTATCTGAACAACCCCCCGATGCCTGGGGCACTGGGGGCCAGCGGAAGCAGC GGCCACGAACTCTCTGCGCTAGGCGGTGAGGGTGGCCTGCAGAGCCTGCTGGGAAACATG AGCCACAGCCAGCTCATGCAGCTCATCGGACCAGCCGGCCTCGGAGGACTGGGTGGGCTG GGGGCCCTGACTGGACCTGGCCTGGCCAGTTTACTGGGGAGCAGTGGGCCTCCAGGGAGC AGCTCCTCCTCCAGCTCCCGGAGCCAGTCGGCAGCGGTCACCCCGTCATCCACCACCTCT TCCACCCGTGCCACCCCAGCCCCTTCTGCTCCAGCAGCTGCCTCAGCAACTAGCCCGAGC CCCGCGCCCAGTTCCGGGAATGGAGCCAGCACAGCAGCCAGCCCGACCCAGCCCATCCAG CTGAGCGACCTCCAGAGCATCCTGGCCACGATGAACGTACCAGCCGGGCCAGCAGGCGGC CAGCAAGTGGACCTGGCCAGTGTGCTGACGCCGGAGATAATGGCTCCCATCCTCGCCAAC GCGGATGTCCAGGAGCGCCTGCTTCCCTACTTGCCATCTGGGGAGTCGCTGCCGCAGACC GCGGATGAGATCCAGAATACCCTGACCTCGCCCCAGTTCCAGCAGGCCCTGGGCATGTTC AGCGCAGCCTTGGCCTCGGGGCAGCTGGGCCCCCTCATGTGCCAGTTCGGTCTGCCTGCA GAGGCTGTGGAGGCCGCCAACAAGGGCGATGTGGAAGCGTTTGCCAAAGCCATGCAGAAC AACGCCAAGCCCGAGCAGAAAGAGGGCGACACGAAGGACAAGAAGGACGAAGAGGAGGAC ATGAGCCTGGACTGAGCCACGCGCCGTCCTCCGAGGAACTGGGCGCTTGCAGTGCGTTGC ACACCCTCACCTCCCACCCACTGATTATTAATAAAGTCTTTTCTTTTACCTGCCAAAAAA AAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_175573 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_175573.1, NP_783163.1 |
RefSeq Size | 1406 bp |
RefSeq ORF | 1224 bp |
Locus ID | 11047 |
UniProt ID | Q16186 |
Gene Summary | This gene encodes a member of the adhesion regulating molecule 1 protein family. The encoded protein is a component of the proteasome where it acts as a ubiquitin receptor and recruits the deubiquitinating enzyme, ubiquitin carboxyl-terminal hydrolase L5. Increased levels of the encoded protein are associated with increased cell adhesion, which is likely an indirect effect of this intracellular protein. Dysregulation of this gene has been implicated in carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
A bis-Benzylidine Piperidone Targeting Proteasome Ubiquitin Receptor RPN13/ADRM1 as a Therapy for Cancer
,Anchoori, RK;Karanam, B;Peng, S;Wang, JW;Jiang, R;Tanno, T;Orlowski, RZ;Matsui, W;Zhao, M;Rudek, MA;Hung, CF;Chen, X;Walters, KJ;Roden, RB;,
Cancer Cell Dec 2013.
,PubMed ID 24332045
[ADRM1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205671 | ADRM1 (Myc-DDK-tagged)-Human adhesion regulating molecule 1 (ADRM1), transcript variant 2 |
CNY 3,656.00 |
|
RC205671L1 | Lenti ORF clone of Human adhesion regulating molecule 1 (ADRM1), transcript variant 2, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC205671L2 | Lenti ORF clone of Human adhesion regulating molecule 1 (ADRM1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC205671L3 | Lenti ORF clone of Human adhesion regulating molecule 1 (ADRM1), transcript variant 2, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC205671L4 | Lenti ORF clone of Human adhesion regulating molecule 1 (ADRM1), transcript variant 2, mGFP tagged |
CNY 6,056.00 |
|
RG205671 | ADRM1 (tGFP-tagged) - Human adhesion regulating molecule 1 (ADRM1), transcript variant 2 |
CNY 5,256.00 |
|
SC108423 | ADRM1 (untagged)-Human adhesion regulating molecule 1 (ADRM1), transcript variant 2 |
CNY 7,220.00 |