KRTCAP2 (NM_173852) Human Untagged Clone
CAT#: SC320977
KRTCAP2 (untagged)-Human keratinocyte associated protein 2 (KRTCAP2)
CNY 1,200.00
CNY 2,950.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KCP2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_173852.3
GGGGGGAGTAGCAAGTCCGCGGTAAGCGCTGACGCATGCGCATAGCTAACCGCACCCGGT
TCAGCTCGCCTTTCTTGGCCAGAGGCGCCGGTTGGACTCACGGGCGGGGCATGATGGTGG TGGGTACGGTCACCTCGCTGGCGCTCTCCTCCCTCCTGTCCCTGCTGCTCTTTGCTGGGA TGCAGATGTACAGCCGTCAGCTGGCCTCCACCGAGTGGCTCACCATCCAGGGCGGCCTGC TTGGTTCGGGTCTCTTCGTGTTCTCGCTCACTGCCTTCAATAATCTGGAGAATCTTGTCT TTGGCAAAGGATTCCAAGCAAAGATCTTCCCTGAGATTCTCCTCTGCCTCCTGTTGGCTC TCTTTGCATCTGGCCTCATCCACCGAGTCTGTGTCACCACCTGCTTCATCTTCTCCATGG TTGGTCTGTACTACATCAACAAGATCTCCTCCACCCTGTACCAGGCAGCAGCTCCAGTCC TCACACCAGCCAAGGTCACAGGCAAGAGCAAGAAGAGAAACTGACCCTGAATGTTCAATA AAGTTGATTCTTCGAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_173852 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173852.3, NP_776251.1 |
RefSeq Size | 577 bp |
RefSeq ORF | 489 bp |
Locus ID | 200185 |
UniProt ID | Q8N6L1 |
Protein Families | Transmembrane |
Gene Summary | Subunit of the oligosaccharyl transferase (OST) complex that catalyzes the initial transfer of a defined glycan (Glc(3)Man(9)GlcNAc(2) in eukaryotes) from the lipid carrier dolichol-pyrophosphate to an asparagine residue within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains, the first step in protein N-glycosylation. N-glycosylation occurs cotranslationally and the complex associates with the Sec61 complex at the channel-forming translocon complex that mediates protein translocation across the endoplasmic reticulum (ER). All subunits are required for a maximal enzyme activity (PubMed:22467853). May be involved in N-glycosylation of APP (amyloid-beta precursor protein). Can modulate gamma-secretase cleavage of APP by enhancing endoprotelysis of PSEN1 (PubMed:21768116).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Keratinocyte-associated protein 2 is a bona fide subunit of the mammalian oligosaccharyltransferase
,Peristera Roboti and Stephen High,
J. Cell Sci., Jan 2012; 125: 220 - 232.
[KRTCAP2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208887 | KRTCAP2 (Myc-DDK-tagged)-Human keratinocyte associated protein 2 (KRTCAP2) |
CNY 1,200.00 |
|
RC208887L1 | Lenti ORF clone of Human keratinocyte associated protein 2 (KRTCAP2), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC208887L2 | Lenti ORF clone of Human keratinocyte associated protein 2 (KRTCAP2), mGFP tagged |
CNY 5,890.00 |
|
RC208887L3 | Lenti ORF clone of Human keratinocyte associated protein 2 (KRTCAP2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208887L4 | Lenti ORF clone of Human keratinocyte associated protein 2 (KRTCAP2), mGFP tagged |
CNY 5,890.00 |
|
RG208887 | KRTCAP2 (tGFP-tagged) - Human keratinocyte associated protein 2 (KRTCAP2) |
CNY 4,370.00 |
|
SC101215 | KRTCAP2 (untagged)-Human keratinocyte associated protein 2 (KRTCAP2) |
CNY 1,200.00 |
其它KRTCAP2产品