SPANX (SPANXC) (NM_022661) Human Untagged Clone

CAT#: SC321127

SPANXC (untagged)-Human SPANX family, member C (SPANXC)



  "NM_022661" in other vectors (5)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-SPANX-C antibody
    • 500 ug

CNY 8,869.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT11.3; CTp11; SPANX-C; SPANX-E; SPANXE
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_022661 edited
GAATTCGGCCATTACGGCCGGGGGCGAAGATTCAAAACCTACAAAAGCCTGCCGCAGACA
TTGAAGAACCAATATATACAATGGACAAACAATCCAGTGCCGGCGGGGTGAAGAGGAGCG
TCCCCTGTGAATCCAACGAGGTGAATGAGACGATGCCGGAGACCCCAACTGGGGACTCAG
ACCCGCAACCTGCTCCTAAAAAAATGAAAACATCTGAGTCCTCGACCATACTAGTGGTTC
GCTACAGGAGGAACGTGAAAAGAACATCTCCAGAGGAACTGCTGAATGACCACGCCCGAG
AGAACAGAATCAACCCCCTCCAAATGGAGGAGGAGGAATTCATGGAAATAATGGTTGAAA
TACCTGCAAAGTAGCAAGAAGCTACATCTCTCAACCTTGGGCAATGAAAATAAAGTTTGA
GAAGCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACATGTCGGCCGCCTCGGCCCTCG
ACTCT
Restriction Sites Please inquire     
ACCN NM_022661
Insert Size 450 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation It was fully sequenced and the DNA sequence matches with that of NM_022661.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022661.2, NP_073152.1
RefSeq Size 425 bp
RefSeq ORF 294 bp
Locus ID 64663
UniProt ID Q9NY87
Gene Summary Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family, which is located in a gene cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene encodes a protein that localizes to the nucleus and is expressed in highly metastatic cell lines, making the protein a potential diagnostic and prognostic marker. The protein belongs to a family of cancer/testis antigens and represents a potential target for cancer immunotherapy. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...