CDCA4 (NM_017955) Human Untagged Clone
CAT#: SC321232
CDCA4 (untagged)-Human cell division cycle associated 4 (CDCA4), transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HEPP; SEI-3/HEPP |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_017955.2
GGAAGCTGGCGGCAGCGGCGGTGGCGGTGGCTGAGCAGAGGACCCGGCGGGCGGCCTCGC
GGGTCAGGACACAATGTTTGCACGAGGACTGAAGAGGAAATGTGTTGGCCACGAGGAAGA CGTGGAGGGAGCCCTGGCCGGCTTGAAGACAGTGTCCTCATACAGCCTGCAGCGGCAGTC GCTCCTGGACATGTCTCTGGTGAAGTTGCAGCTTTGCCACATGCTTGTGGAGCCCAATCT GTGCCGCTCAGTCCTCATTGCCAACACGGTCCGGCAGATCCAAGAGGAGATGACGCAGGA TGGGACGTGGCGCACAGTGGCACCCCAGGCTGCAGAGCGGGCGCCGCTCAACCGCTTGGT CTCCACGGAGATCCTGTGCCGTGCAGCGTGGGGGCAAGAGGGGGCACATCCTGCTCCTGG CTTGGGGGACGGCCACACACAGGGTCCAGTTTCTGACCTTTGCCCAGTCACCTCAGCACA GGCACCAAGGCACCTGCAGAGCAGCGCCTGGGAGATGGATGGCCCTCGAGAAAACAGAGG AAGCTTTCACAAGTCACTTGATCAGATATTTGAAACGCTGGAGACTAAAAACCCCAGCTG CATGGAAGAGCTGTTCTCAGACGTGGACAGCCCCTACTACGACCTGGACACAGTACTGAC AGGCATGATGGGGGGTGCCAGGCCGGGCCCCTGCGAAGGGCTCGAGGGCTTGGCTCCGGC CACCCCAGGCCCTAGCTCCAGCTGCAAGTCCGACCTGGGCGAGCTGGACCACGTGGTGGA GATCCTGGTGGAGACCTGAGCAGGAGCCCTGAGTGCTCACAGCCGCCTCTGACGCATTGA CACGTGAGCACTGGCTCCCACGGAGGGTGCGCCTGCCGCCAGCGGCCCAGCCTTGCTGCC CTGTCTGCTGATTCTGAGAAATCCCAGAACAGCCCATTACCAGTGGGGCTGCAGCCCTAG GCCCGTCCCACTCACCTCCCCCCTGTGGAGGGCCAGGCAGAGGCTGTTCTGGAAGGCTTC TTGTCTTCTGACGTCCCCACAGCCCTGGGCCCCTCGTGTCTCTTTGTGTCCCCCACTGTA GAGGACGGTGAGCCGCAGCTGCATCAACCTCCTTTTACCTTTAGATAGGTGAATTTTTAC AATTCAGTTTTACATGTTTTGGGCAGTATTTTGTCTTAAGATATATTTTTTAAACTTTTT ATACCTTATCTCTTTAGATTTTTTCAGCTATTTTCTTAAAAGTATATTTTTTCTATAAAC ATCCTTTGCTGCTACATTAGAACTTTTATAGCCTAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_017955 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_017955.2, NP_060425.2 |
RefSeq Size | 2171 bp |
RefSeq ORF | 726 bp |
Locus ID | 55038 |
UniProt ID | Q9BXL8 |
Protein Families | ES Cell Differentiation/IPS |
Gene Summary | This gene encodes a protein that belongs to the E2F family of transcription factors. This protein regulates E2F-dependent transcriptional activation and cell proliferation, mainly through the E2F/retinoblastoma protein pathway. It also functions in the regulation of JUN oncogene expression. This protein shows distinctive nuclear-mitotic apparatus distribution, it is involved in spindle organization from prometaphase, and may also play a role as a midzone factor involved in chromosome segregation or cytokinesis. Two alternatively spliced transcript variants encoding the same protein have been noted for this gene. Two pseudogenes have also been identified on chromosome 1. [provided by RefSeq, May 2014] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206833 | CDCA4 (Myc-DDK-tagged)-Human cell division cycle associated 4 (CDCA4), transcript variant 1 |
CNY 2,400.00 |
|
RC206833L3 | Lenti ORF clone of Human cell division cycle associated 4 (CDCA4), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC206833L4 | Lenti ORF clone of Human cell division cycle associated 4 (CDCA4), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG206833 | CDCA4 (tGFP-tagged) - Human cell division cycle associated 4 (CDCA4), transcript variant 1 |
CNY 4,000.00 |