MGMT (NM_002412) Human Untagged Clone

CAT#: SC322190

MGMT (untagged)-Human O-6-methylguanine-DNA methyltransferase (MGMT)



  "NM_002412" in other vectors (12)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Cited in 2 publications.

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MGMT mouse monoclonal antibody, clone OTI2F10 (formerly 2F10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322190 GACGCCCGCAGGTCCTCGCGGTGCGCACCGTTTGCGACTTGGTACTTGGAAAAATGGACA
AGGATTGTGAAATGAAACGCACCACACTGGACAGCCCTTTGGGGAAGCTGGAGCTGTCTG
GTTGTGAGCAGGGTCTGCACGAAATAAAGCTCCTGGGCAAGGGGACGTCTGCAGCTGATG
CCGTGGAGGTCCCAGCCCCCGCTGCGGTTCTCGGAGGTCCGGAGCCCCTGATGCAGTGCA
CAGCCTGGCTGAATGCCTATTTCCACCAGCCCGAGGCTATCGAAGAGTTCCCCGTGCCGG
CTCTTCACCATCCCGTTTTCCAGCAAGAGTCGTTCACCAGACAGGTGTTATGGAAGCTGC
TGAAGGTTGTGAAATTCGGAGAAGTGATTTCTTACCAGCAATTAGCAGCCCTGGCAGGCA
ACCCCAAAGCCGCGCGAGCAGTGGGAGGAGCAATGAGAGGCAATCCTGTCCCCATCCTCA
TCCCGTGCCACAGAGTGGTCTGCAGCAGCGGAGCCGTGGGCAACTACTCCGGAGGACTGG
CCGTGAAGGAATGGCTTCTGGCCCATGAAGGCCACCGGTTGGGGAAGCCAGGCTTGGGAG
GGAGCTCAGGTCTGGCAGGGGCCTGGCTCAAGGGAGCGGGAGCTACCTCGGGCTCCCCGC
CTGCTGGCCGAAACTGAGTATGTGCAGTAGGATGGATGTTTGAGCGACACACACGTGTAA
CACTGCATCGGATGCGGGGCGTGGAGGCACCGCTGTATTAAAGGAAGTGGCAGTGTCCTG
GGAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_002412
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002412.2, NP_002403.1
RefSeq Size 1265 bp
RefSeq ORF 624 bp
Locus ID 4255
UniProt ID P16455
Domains Methyltransf_1
Protein Families Druggable Genome
Gene Summary Alkylating agents are potent carcinogens that can result in cell death, mutation and cancer. The protein encoded by this gene is a DNA repair protein that is involved in cellular defense against mutagenesis and toxicity from alkylating agents. The protein catalyzes transfer of methyl groups from O(6)-alkylguanine and other methylated moieties of the DNA to its own molecule, which repairs the toxic lesions. Methylation of the genes promoter has been associated with several cancer types, including colorectal cancer, lung cancer, lymphoma and glioblastoma. [provided by RefSeq, Sep 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Other Versions

Customer Reviews 
Loading...