PPAR gamma (PPARG) (NM_138712) Human Untagged Clone
CAT#: SC322218
PPARG (untagged)-Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1
CNY 5,488.00
Cited in 3 publications. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_138712 edited
CCAGAAGCCTGCATTTCTGCATTCTGCTTAATTCCCTTTCCTTAGATTTGAAAGAAGCCA ACACTAAACCACAAATATACAACAAGGCCATTTTCTCAAACGAGAGTCAGCCTTTAACGA AATGACCATGGTTGACACAGAGATGCCATTCTGGCCCACCAACTTTGGGATCAGCTCCGT GGATCTCTCCGTAATGGAAGACCACTCCCACTCCTTTGATATCAAGCCCTTCACTACTGT TGACTTCTCCAGCATTTCTACTCCACATTACGAAGACATTCCATTCACAAGAACAGATCC AGTGGTTGCAGATTACAAGTATGACCTGAAACTTCAAGAGTACCAAAGTGCAATCAAAGT GGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACTCAGCTCTACAATAAGCCTCATGA AGAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGTGTCTGTGGAGATAAAGCTTCTGG ATTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAGGGTTTCTTCCGGAGAACAATCAG ATTGAAGCTTATCTATGACAGATGTGATCTTAACTGTCGGATCCACAAAAAAAGTAGAAA TAAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCAGTGGGGATGTCTCATAATGCCAT CAGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAGCTGTTGGCGGAGATCTCCAGTGA TATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGGGCCCTGGCAAAACATTTGTATGA CTCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAGGCGAGGGCGATCTTGACAGGAAA GACAACAGACAAATCACCATTCGTTATCTATGACATGAATTCCTTAATGATGGGAGAAGA TAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAGCAGAGCAAAGAGGTGGCCATCCG CATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCTGTGCAGGAGATCACAGAGTATGC CAAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAACGACCAAGTAACTCTCCTCAAATA TGGAGTCCACGAGATCATTTACACAATGCTGGCCTCCTTGATGAATAAAGATGGGGTTCT CATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTTCTAAAGAGCCTGCGAAAGCCTTT TGGTGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTGAAGTTCAATGCACTGGAATTAGA TGACAGCGACTTGGCAATATTTATTGCTGTCATTATTCTCAGTGGAGACCGCCCAGGTTT GCTGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGGAGCTCCA GCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAGAAAATGAC AGACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGA GACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTAGCAGAG AGTCCTGAGCCACTGCCAACATTTCCCTTCTTCCAGTTGCACTATTCTGAGGGAAAATCT GACACCTAAGAAATTTACTGTGAAAAAGCATTTTAAAAAGAAAAGGTTTTAGAATATGAT CTATTTTATGCATATTGTTTATAAAGACACATTTACAATTTACTTTTAATATTAAAAATT ACCATATTATGAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_138712 |
Insert Size | 1800 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138712.2, NP_619726.1 |
RefSeq Size | 1883 bp |
RefSeq ORF | 1428 bp |
Locus ID | 5468 |
UniProt ID | P37231 |
Domains | HOLI, zf-C4 |
Protein Families | Druggable Genome, Nuclear Hormone Receptor, Transcription Factors |
Protein Pathways | Huntington's disease, Pathways in cancer, PPAR signaling pathway, Thyroid cancer |
Gene Summary | This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) differs in the 5' UTR and 5' coding region compared to variant 2. Variants 1, 3, 4, 6, and 7 all encode the same isoform (1), which has a shorter, distinct N-terminus compared to isoform 2. |
Citations (3)
The use of this cDNA Clones has been cited in the following citations: |
---|
Peroxisome proliferator-activated receptor ?-mediated induction of microRNA-145 opposes tumor phenotype in colorectal cancer
,Panza, A;Votino, C;Gentile, A;Valvano, MR;Colangelo, T;Pancione, M;Merla, G;Andriulli, A;Sabatino, L;Vinciguerra, M;Mazzoccoli, G;Colantuoni, V;Piepoli, A;,
Biochim. Biophys. Acta
,PubMed ID 24631504
[PPAR gamma]
|
CD146(+) Human Umbilical Cord Perivascular Cells Maintain Stemness under Hypoxia and as a Cell Source for Skeletal Regeneration
,Tsang, WP;Shu, Y;Kwok, PL;Zhang, F;Lee, KK;Tang, MK;Li, G;Chan, KM;Chan, WY;Wan, C;,
PLoS ONE e76153
,PubMed ID 24204598
[PPAR gamma]
|
CD146+ Human Umbilical Cord Perivascular Cells Maintain Stemness under Hypoxia and as a Cell Source for Skeletal Regeneration
,Tsang, WP;Shu, Y;Kwok, PL;Zhang, F;Lee, KKH;,
PLOS One DOI: 10.1371/journal.pone.0076153
[PPAR gamma]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201538 | PPARG (Myc-DDK-tagged)-Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1 |
CNY 5,488.00 |
|
RC201538L3 | Lenti ORF clone of Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC201538L4 | Lenti ORF clone of Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RG201538 | PPARG (tGFP-tagged) - Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1 |
CNY 7,088.00 |
|
SC124177 | PPARG (untagged)-Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1 |
CNY 5,488.00 |
|
SC317792 | PPARG (untagged)-Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1 |
CNY 7,220.00 |
其它PPAR gamma产品