CNBP (NM_001127192) Human Untagged Clone
CAT#: SC322871
CNBP (untagged)-Human CCHC-type zinc finger, nucleic acid binding protein (CNBP), transcript variant 1
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CNBP1; DM2; PROMM; RNF163; ZCCHC22; ZNF9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322871 representing NM_001127192.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGTCCTACTGGTGGA GGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTGGTTTTACCTCGGATAGAGGTTTCCAGTTTGTT TCCTCGTCTCTTCCAGACATTTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTT CAGGAGGATGTTGAAGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCC AAGAGAGAGCGAGAGCAATGCTGCTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGCGACCAT GCAGATGAGCAGAAATGCTATTCTTGTGGAGAATTCGGACACATTCAAAAAGACTGCACCAAAGTGAAG TGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTAC CGCTGTGGCGAGTCAGGGCACCTTGCACGGGAATGCACAATTGAGGCTACAGCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127192 |
Insert Size | 540 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127192.1 |
RefSeq Size | 3399 bp |
RefSeq ORF | 540 bp |
Locus ID | 7555 |
UniProt ID | P62633 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 19.7 kDa |
Gene Summary | This gene encodes a nucleic-acid binding protein with seven zinc-finger domains. The protein has a preference for binding single stranded DNA and RNA. The protein functions in cap-independent translation of ornithine decarboxylase mRNA, and may also function in sterol-mediated transcriptional regulation. A CCTG expansion from <30 repeats to 75-11000 repeats in the first intron of this gene results in myotonic dystrophy type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016] Transcript Variant: This variant represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225190 | CNBP (Myc-DDK-tagged)-Human CCHC-type zinc finger, nucleic acid binding protein (CNBP), transcript variant 1 |
CNY 3,600.00 |
|
RC225190L3 | Lenti-ORF clone of CNBP (Myc-DDK-tagged)-Human CCHC-type zinc finger, nucleic acid binding protein (CNBP), transcript variant 1 |
CNY 5,890.00 |
|
RC225190L4 | Lenti-ORF clone of CNBP (mGFP-tagged)-Human CCHC-type zinc finger, nucleic acid binding protein (CNBP), transcript variant 1 |
CNY 5,890.00 |
|
RG225190 | CNBP (tGFP-tagged) - Human CCHC-type zinc finger, nucleic acid binding protein (CNBP), transcript variant 1 |
CNY 5,200.00 |