HDGF (NM_001126050) Human Untagged Clone

CAT#: SC322925

HDGF (untagged)-Human hepatoma-derived growth factor (HDGF), transcript variant 2



  "NM_001126050" in other vectors (4)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit anti-HDGF Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HMG1L2
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001126050, the custom clone sequence may differ by one or more nucleotides


ATGCACCCGGAAGGTGGCCAATTTGTGCCTCAACTCCTTGGCCATCTCCTGGCTACCAAACTCAAGCGTT
TCCTCCTTAGCAAAGGCGGACGTAGGGCTCAAATCCCCGACGTTTCCAGGGCCACCCCCCATACGATTGA
CGAGATGCCTGAGGCTGCCGTGAAATCAACAGCCAACAAATACCAAGTCTTTTTTTTCGGGACCCACGAG
ACGGCATTCCTGGGCCCCAAAGACCTCTTCCCTTACGAGGAATCCAAGGAGAAGTTTGGCAAGCCCAACA
AGAGGAAAGGGTTCAGCGAGGGGCTGTGGGAGATCGAGAACAACCCTACTGTCAAGGCTTCCGGCTATCA
GTCCTCCCAGAAAAAGAGCTGTGTGGAAGAGCCTGAACCAGAGCCCGAAGCTGCAGAGGGTGACGGTGAT
AAGAAGGGGAATGCAGAGGGCAGCAGCGACGAGGAAGGGAAGCTGGTCATTGATGAGCCAGCCAAGGAGA
AGAACGAGAAAGGAGCGTTGAAGAGGAGAGCAGGGGACTTGCTGGAGGACTCTCCTAAACGTCCCAAGGA
GGCAGAAAACCCTGAAGGAGAGGAGAAGGAGGCAGCCACCTTGGAGGTTGAGAGGCCCCTTCCTATGGAG
GTGGAAAAGAATAGCACCCCCTCTGAGCCCGGCTCTGGCCGGGGGCCTCCCCAAGAGGAAGAAGAAGAGG
AGGATGAAGAGGAAGAGGCTACCAAGGAAGATGCTGAGGCCCCAGGCATCAGAGATCATGAGAGCCTGTA
G


Restriction Sites Please inquire     
ACCN NM_001126050
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001126050.1, NP_001119522.1
RefSeq Size 2208 bp
RefSeq ORF 771 bp
Locus ID 3068
UniProt ID P51858
Gene Summary This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (2) differs uses an alternate in-frame splice junction compared to variant 4. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform d.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...