United States
Germany
Japan
United Kingdom
China
delta Sarcoglycan (SGCD) (NM_001128209) Human Untagged Clone
CAT＃: SC322952
SGCD (untagged)-Human sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) (SGCD), transcript variant 3
CNY 6,270.00
Product images
CNY 1,999.00
CNY 3,340.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 35DAG; CMD1L; DAGD; LGMDR6; SG-delta; SGCDP; SGD |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC322952 representing NM_001128209.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCTCAGGAGCAGTACACTCACCACCGGAGCACCATGCCTGGCTCTGTGGGGCCACAGGTATACAAG GTGGGGATTTATGGCTGGCGGAAACGATGCCTGTATTTCTTTGTCCTGCTCCTCATGATTTTAATACTG GTGAACTTGGCCATGACCATCTGGATTCTCAAAGTCATGAACTTCACAATTGATGGAATGGGAAACCTG AGGATCACAGAAAAAGGTCTAAAGCTAGAAGGAGACTCTGAATTCTTACAACCTCTCTACGCCAAAGAA ATCCAGTCCCGACCAGGTAATGCCCTGTACTTCAAGTCTGCCAGAAATGTTACAGTGAACATTCTCAAT GACCAGACTAAAGTGCTAACTCAGCTTATAACAGGTCCAAAAGCCGTAGAAGCTTATGGTAAAAAATTT GAGGTAAAAACTGTTTCTGGAAAATTGCTCTTCTCTGCAGACAATAATGAAGTGGTAGTAGGAGCTGAA AGATTACGAGTTTTAGGAGCGGAGGGCACAGTGTTCCCTAAATCTATAGAAACACCTAATGTCAGGGCA GACCCCTTCAAAGAACTAAGGTTGGAGTCCCCAACCCGGTCTCTAGTGATGGAGGCCCCAAAAGGAGTG GAAATCAATGCAGAAGCTGGCAATATGGAAGCCACCTGCAGGACAGAGCTGAGACTGGAATCCAAAGAT GGAGAGATTAAGTTAGATGCTGCGAAAATCAGGCTACCTAGACTGCCTCATGGATCCTACACGCCTACA GGAACGAGGCAGAAGGTCTTCGAGATCTGCGTCTGCGCCAATGGGAGATTATTCCTGTCTCAGGCAGGA GCTGGGTCCACTTGTCAGATAAACACAAGTGTCTGCCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001128209 |
| Insert Size | 870 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001128209.1 |
| RefSeq Size | 9759 bp |
| RefSeq ORF | 870 bp |
| Locus ID | 6444 |
| UniProt ID | Q92629 |
| Protein Families | Transmembrane |
| Protein Pathways | Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), Viral myocarditis |
| MW | 32.1 kDa |
| Gene Summary | The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) is lacking an internal exon from the 5' end compared to transcript variant 1, resulting in translation initiation from the second in-frame AUG, and an isoform (3) missing 1 aa at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225399 | SGCD (Myc-DDK-tagged)-Human sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) (SGCD), transcript variant 3 |
CNY 2,400.00 |
|
| RC225399L3 | Lenti ORF clone of Human sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) (SGCD), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225399L4 | Lenti ORF clone of Human sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) (SGCD), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG225399 | SGCD (tGFP-tagged) - Human sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) (SGCD), transcript variant 3 |
CNY 4,370.00 |
其它delta Sarcoglycan产品
