Heme oxygenase 2 (HMOX2) (NM_001127204) Human Untagged Clone

CAT#: SC322968

HMOX2 (untagged)-Human heme oxygenase (decycling) 2 (HMOX2), transcript variant 1



  "NM_001127204" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
HMOX2 (Heme oxygenase 2) mouse monoclonal antibody, clone OTI1C2 (formerly 1C2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HO-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322968 representing NM_001127204.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCAGCGGAAGTGGAAACCTCAGAGGGGGTAGACGAGTCAGAAAAAAAGAACTCTGGGGCCCTAGAA
AAGGAGAACCAAATGAGAATGGCTGACCTCTCGGAGCTCCTGAAGGAAGGGACCAAGGAAGCACACGAC
CGGGCAGAAAACACCCAGTTTGTCAAGGACTTCTTGAAAGGCAACATTAAGAAGGAGCTGTTTAAGCTG
GCCACCACGGCACTTTACTTCACATACTCAGCCCTCGAGGAGGAAATGGAGCGCAACAAGGACCATCCA
GCCTTTGCCCCTTTGTACTTCCCCATGGAGCTGCACCGGAAGGAGGCGCTGACCAAGGACATGGAGTAT
TTCTTTGGTGAAAACTGGGAGGAGCAGGTGCAGTGCCCCAAGGCTGCCCAGAAGTACGTGGAGCGGATC
CACTACATAGGGCAGAACGAGCCGGAGCTACTGGTGGCCCATGCATACACCCGCTACATGGGGGATCTC
TCGGGGGGCCAGGTGCTGAAGAAGGTGGCCCAGCGAGCACTGAAACTCCCCAGCACAGGGGAAGGGACC
CAGTTCTACCTGTTTGAGAATGTGGACAATGCCCAGCAGTTCAAGCAGCTCTACCGGGCCAGGATGAAC
GCCCTGGACCTGAACATGAAGACCAAAGAGAGGATCGTGGAGGAGGCCAACAAGGCTTTTGAGTATAAC
ATGCAGATATTCAATGAACTGGACCAGGCCGGCTCCACACTGGCCAGAGAGACCTTGGAGGATGGGTTC
CCTGTACACGATGGGAAAGGAGACATGCGTAAATGCCCTTTCTACGCTGCTGAACAAGACAAAGGTGCC
CTGGAGGGCAGCAGCTGTCCCTTCCGAACAGCTATGGCTGTGCTGAGGAAGCCCAGCCTCCAGTTCATC
CTGGCCGCTGGTGTGGCCCTAGCTGCTGGACTCTTGGCCTGGTACTACATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001127204
Insert Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001127204.1
RefSeq Size 1872 bp
RefSeq ORF 951 bp
Locus ID 3163
UniProt ID P30519
Protein Families Transmembrane
Protein Pathways Porphyrin and chlorophyll metabolism
MW 36 kDa
Gene Summary Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (1) differs in the 5' UTR and coding sequence compared to variant 5. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 1, 2, 3, 4, 6, 7, and 8 all encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...