United States
Germany
Japan
United Kingdom
China
LKB1 (STK11) (NM_000455) Human Untagged Clone
CAT＃: SC323432
STK11 (untagged)-Kinase deficient mutant (K78M) of Human serine/threonine kinase 11 (STK11)
CNY 5,488.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | hLKB1; LKB1; PJS |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_000455 edited
ATGGAGGTGGTGGACCCGCAGCAGCTGGGCATGTTCACGGAGGGCGAGCTGATGTCGGTG GGTATGGACACGTTCATCCACCGCATCGACTCCACCGAGGTCATCTACCAGCCGCGCCGC AAGCGGGCCAAGCTCATCGGCAAGTACCTGATGGGGGACCTGCTGGGGGAAGGCTCTTAC GGCAAGGTGAAGGAGGTGCTGGACTCGGAGACGCTGTGCAGGAGGGCCGTCATGATCCTC AAGAAGAAGAAGTTGCGAAGGATCCCCAACGGGGAGGCCAACGTGAAGAAGGAAATTCAA CTACTGAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAA GAGAAGCAGAAAATGTATATGGTGATGGAGTACTGCGTGTGTGGCATGCAGGAAATGCTG GACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTG ATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGG AACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCA CTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAG CCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCG GCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATC TACAAGTTGTTTGAGAACATCGGGAAGGGGAGCTACGCCATCCCGGGCGACTGTGGCCCC CCGCTCTCTGACCTGCTGAAAGGGATGCTTGAGTACGAACCGGCCAAGAGGTTCTCCATC CGGCAGATCCGGCAGCACAGCTGGTTCCGGAAGAAACATCCTCCGGCTGAAGCACCAGTG CCCATCCCACCGAGCCCAGACACCAAGGACCGGTGGCGCAGCATGACTGTGGTGCCGTAC TTGGAGGACCTGCACGGCGCGGACGAGGACGAGGACCTCTTCGACATCGAGGATGACATC ATCTACACTCAGGACTTCACGGTGCCCGGACAGGTCCCAGAAGAGGAGGCCAGTCACAAT GGACAGCGCCGGGGCCTCCCCAAGGCCGTGTGTATGAACGGCACAGAGGCGGCGCAGCTG AGCACCAAATCCAGGGCGGAGGGCCGGGCCCCCAACCCTGCCCGCAAGGCCTGCTCCGCC AGCAGCAAGATCCGCCGGCTGTCGGCCTGCAAGCAGCAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_000455 |
| Insert Size | 2500 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000455.4, NP_000446.1 |
| RefSeq Size | 3286 bp |
| RefSeq ORF | 1302 bp |
| Locus ID | 6794 |
| UniProt ID | Q15831 |
| Domains | pkinase, TyrKc, S_TKc |
| Protein Families | Druggable Genome, Protein Kinase |
| Protein Pathways | Adipocytokine signaling pathway, mTOR signaling pathway |
| Gene Summary | This gene, which encodes a member of the serine/threonine kinase family, regulates cell polarity and functions as a tumor suppressor. Mutations in this gene have been associated with Peutz-Jeghers syndrome, an autosomal dominant disorder characterized by the growth of polyps in the gastrointestinal tract, pigmented macules on the skin and mouth, and other neoplasms. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Autophagy Is a Cell Self-Protective Mechanism Against Arsenic-Induced Cell Transformation
,Tao Zhang, Yuanlin Qi, Mingjun Liao, Mei Xu, Kimberley A. Bower, Jacqueline A. Frank, Han-Ming Shen, Jia Luo, Xianglin Shi, and Gang Chen,
Toxicol. Sci., Dec 2012; 130: 298 - 308.
[STK11]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202885 | STK11 (Myc-DDK-tagged)-Human serine/threonine kinase 11 (STK11) |
CNY 5,488.00 |
|
| RC202885L1 | Lenti ORF clone of Human serine/threonine kinase 11 (STK11), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC202885L2 | Lenti ORF clone of Human serine/threonine kinase 11 (STK11), mGFP tagged |
CNY 7,888.00 |
|
| RC202885L3 | Lenti ORF clone of Human serine/threonine kinase 11 (STK11), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC202885L4 | Lenti ORF clone of Human serine/threonine kinase 11 (STK11), mGFP tagged |
CNY 7,888.00 |
|
| RG202885 | STK11 (tGFP-tagged) - Human serine/threonine kinase 11 (STK11) |
CNY 7,088.00 |
|
| SC119871 | STK11 (untagged)-Human serine/threonine kinase 11 (STK11) |
CNY 5,488.00 |
