United States
Germany
Japan
United Kingdom
China
Spasmolytic Polypeptide (TFF2) (NM_005423) Human Untagged Clone
CAT＃: SC323966
TFF2 (untagged)-Human trefoil factor 2 (TFF2)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SML1; SP |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_005423.3
TGGGGTGCAGCTGAGCTAGACATGGGACGGCGAGACGCCCAGCTCCTGGCAGCGCTCCTC
GTCCTGGGGCTATGTGCCCTGGCGGGGAGTGAGAAACCCTCCCCCTGCCAGTGCTCCAGG CTGAGCCCCCATAACAGGACGAACTGCGGCTTCCCTGGAATCACCAGTGACCAGTGTTTT GACAATGGATGCTGTTTCGACTCCAGTGTCACTGGGGTCCCCTGGTGTTTCCACCCCCTC CCAAAGCAAGAGTCGGATCAGTGCGTCATGGAGGTCTCAGACCGAAGAAACTGTGGCTAC CCGGGCATCAGCCCCGAGGAATGCGCCTCTCGGAAGTGCTGCTTCTCCAACTTCATCTTT GAAGTGCCCTGGTGCTTCTTCCCGAAGTCTGTGGAAGACTGCCATTACTAAGAGAGGCTG GTTCCAGAGGATGCATCTGGCTCACCGGGTGTTCCGAAACCAAAGAAGAAACTTCGCCTT ATCAGCTTCATACTTCATGAAATCCTGGGTTTTCTTAACCATCTTTTCCTCATTTTCAAT GGTTTAACATATAATTTCTTTAAATAAAACCCTTAAAATCTGCAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_005423 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005423.3, NP_005414.1 |
| RefSeq Size | 616 bp |
| RefSeq ORF | 390 bp |
| Locus ID | 7032 |
| UniProt ID | Q03403 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. The encoded protein inhibits gastric acid secretion. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC207571 | TFF2 (Myc-DDK-tagged)-Human trefoil factor 2 (TFF2) |
CNY 1,200.00 |
|
| RC207571L1 | Lenti ORF clone of Human trefoil factor 2 (TFF2), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC207571L2 | Lenti ORF clone of Human trefoil factor 2 (TFF2), mGFP tagged |
CNY 5,890.00 |
|
| RC207571L3 | Lenti ORF clone of Human trefoil factor 2 (TFF2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC207571L4 | Lenti ORF clone of Human trefoil factor 2 (TFF2), mGFP tagged |
CNY 5,890.00 |
|
| RG207571 | TFF2 (tGFP-tagged) - Human trefoil factor 2 (TFF2) |
CNY 2,800.00 |
其它Spasmolytic Polypeptide产品
