United States
Germany
Japan
United Kingdom
China
Pregnancy specific beta 1 glycoprotein 11 (PSG11) (NM_203287) Human Untagged Clone
CAT＃: SC324528
PSG11 (untagged)-Human pregnancy specific beta-1-glycoprotein 11 (PSG11), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PSBG-11; PSBG-13; PSG13; PSG14 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_203287.1
AGAAGGAGGAAGGACAGCACAGCTGACAGCCGTGCTCTGGAAGCTTCTGGATCCTAGGCT
CATCTCCACAGAGGAGAACATGCACGCAGCAGAGATCATGGGGCCCCTCTCAGCCCCTCC CTGCACAGAGCACATCAAATGGAAGGGGCTCCTGCTCACAGTGGAGACTCCCAAGCCCTC CATCTCCAGCAGCAACTTAAACCCCAGGGAGGCCATGGAGACTGTGATCTTAACCTGTAA TCCTGAGACTCCGGACGCAAGCTACCTGTGGTGGATGAATGGTCAGAGCCTCCCTATGAC TCATAGGATGCAGCTGTCTGAAACCAACAGGACCCTCTTTCTATTTGGTGTCACAAAGTA TACTGCAGGACCCTATGAATGTGAAATATGGAACTCAGGGAGTGCCAGCCGCAGTGACCC AGTCACCCTGAATCTCCTCCATGGTCCAGACCTCCCCAGAATTTTCCCTTCAGTCACCTC TTACTATTCAGGAGAGAACCTCGACTTGTCCTGCTTCGCAGACTCTAACCCACCAGCACA GTATTCTTGGACAATTAATGGGAAGTTTCAGCTATCAGGACAAAAGCTCTTTATCCCTCA AATTACTCCAAAGCATAATGGGCTCTATGCTTGCTCTGCTCGTAACTCAGCCACTGGCGA GGAAAGCTCCACATCCTTGACAATCAGAGTCATTGCTCCTCCAGGATTAGGAACTTTTGC TTTCAATAATCCAACGTAGCAGCCGTGATGTCATTTTTGTATTTCAGGAAGACTGGCAGA AAGTTGCTTTGATTCTTCCTCAAAGTATTTAAAATCAGCTACAGTCCAAAATTGCTTTTT CTTCAAGGAGATTTATGGAAAAGACTATGAAAAGGACTCTTGAATACAAGTTCCTGATAA CTTCAAGATCATACCACTGGACTAAGAACTTTCAAAATTTTAATGAACAGGCTGATACCT TCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_203287 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_203287.1, NP_976032.2 |
| RefSeq Size | 1243 bp |
| RefSeq ORF | 642 bp |
| Locus ID | 5680 |
| UniProt ID | Q9UQ72 |
| Protein Families | Secreted Protein |
| Gene Summary | The human pregnancy-specific glycoproteins (PSGs) are a group of molecules that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009] Transcript Variant: This variant (2) differs in the 3' UTR and lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Both variants 2 and 3 encode the same isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204702 | PSG11 (Myc-DDK-tagged)-Human pregnancy specific beta-1-glycoprotein 11 (PSG11), transcript variant 2 |
CNY 2,400.00 |
|
| RC204702L3 | Lenti ORF clone of Human pregnancy specific beta-1-glycoprotein 11 (PSG11), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC204702L4 | Lenti ORF clone of Human pregnancy specific beta-1-glycoprotein 11 (PSG11), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG204702 | PSG11 (tGFP-tagged) - Human pregnancy specific beta-1-glycoprotein 11 (PSG11), transcript variant 2 |
CNY 4,000.00 |
其它Pregnancy specific beta 1 glycoprotein 11产品
