United States
Germany
Japan
United Kingdom
China
HMGB2 (NM_001130689) Human Untagged Clone
CAT＃: SC324789
HMGB2 (untagged)-Human high mobility group box 2 (HMGB2), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HMG2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC324789 representing NM_001130689.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGTAAAGGAGACCCCAACAAGCCGCGGGGCAAAATGTCCTCGTACGCCTTCTTCGTGCAGACCTGC CGGGAAGAGCACAAGAAGAAACACCCGGACTCTTCCGTCAATTTCGCGGAATTCTCCAAGAAGTGTTCG GAGAGATGGAAGACCATGTCTGCAAAGGAGAAGTCGAAGTTTGAAGATATGGCAAAAAGTGACAAAGCT CGCTATGACAGGGAGATGAAAAATTACGTTCCTCCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCC AATGCTCCTAAAAGGCCACCATCTGCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCAAAAGT GAACACCCTGGCCTATCCATTGGGGATACTGCAAAGAAATTGGGTGAAATGTGGTCTGAGCAGTCAGCC AAAGATAAACAACCATATGAACAGAAAGCAGCTAAGCTAAAGGAGAAATATGAAAAGGATATTGCTGCA TATCGTGCCAAGGGCAAAAGTGAAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGAAGAAG AACGAACCAGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGATGAGGAGGAAGAGGATGAAGAT GAAGAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001130689 |
| Insert Size | 630 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001130689.1 |
| RefSeq Size | 1454 bp |
| RefSeq ORF | 630 bp |
| Locus ID | 3148 |
| UniProt ID | P26583 |
| Protein Families | Druggable Genome, Transcription Factors |
| MW | 24 kDa |
| Gene Summary | This gene encodes a member of the non-histone chromosomal high mobility group protein family. The proteins of this family are chromatin-associated and ubiquitously distributed in the nucleus of higher eukaryotic cells. In vitro studies have demonstrated that this protein is able to efficiently bend DNA and form DNA circles. These studies suggest a role in facilitating cooperative interactions between cis-acting proteins by promoting DNA flexibility. This protein was also reported to be involved in the final ligation step in DNA end-joining processes of DNA double-strand breaks repair and V(D)J recombination. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225240 | HMGB2 (Myc-DDK-tagged)-Human high mobility group box 2 (HMGB2), transcript variant 3 |
CNY 2,400.00 |
|
| RC225240L3 | Lenti ORF clone of Human high mobility group box 2 (HMGB2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225240L4 | Lenti ORF clone of Human high mobility group box 2 (HMGB2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG225240 | HMGB2 (tGFP-tagged) - Human high mobility group box 2 (HMGB2), transcript variant 3 |
CNY 4,370.00 |
