United States
Germany
Japan
United Kingdom
China
BAP31 (BCAP31) (NM_001139441) Human Untagged Clone
CAT＃: SC324837
BCAP31 (untagged)-Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 3
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 6C6-AG; BAP31; CDM; DDCH; DXS1357E |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001139441 edited
ATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCGGAGGTCTTTGTTGTGTTG CTTCTCTGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTG GTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTG CTGTTGGTCATCGATGCCGTGCGCGAAATTCGGGAGTATGATGATGTGACGGAAAAGGTG AACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAG AGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTG ACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCG GAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGA GCTGCTGTTGACGGAGGCAAGTTGGATGTCGGGAATGCTGAGGTGAAGTTGGAGGAAGAG AACAGGAGCCTGAAGGCTGACCTGCAGAAGCTAAAGGACGAGCTGGCCAGCACTAAGCAA AAACTAGAGAAAGCTGAAAACCAGGTTCTGGCCATGCGGAAGCAGTCTGAGGGCCTCACC AAGGAGTACGACCGCTTGCTGGAGGAGCACGCAAAGCTGCAGGCTGCAGTAGATGGTCCC ATGGACAAGAAGGAAGAGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001139441 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001139441.1, NP_001132913.1 |
| RefSeq Size | 1346 bp |
| RefSeq ORF | 741 bp |
| Locus ID | 10134 |
| UniProt ID | P51572 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a member of the B-cell receptor associated protein 31 superfamily. The encoded protein is a multi-pass transmembrane protein of the endoplasmic reticulum that is involved in the anterograde transport of membrane proteins from the endoplasmic reticulum to the Golgi and in caspase 8-mediated apoptosis. Microdeletions in this gene are associated with contiguous ABCD1/DXS1375E deletion syndrome (CADDS), a neonatal disorder. Alternative splicing of this gene results in multiple transcript variants. Two related pseudogenes have been identified on chromosome 16. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3 and 4 all encode isoform b. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226633 | BCAP31 (Myc-DDK-tagged)-Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 3 |
CNY 2,400.00 |
|
| RC226633L3 | Lenti ORF clone of Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC226633L4 | Lenti ORF clone of Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 3, mGFP tagged |
CNY 4,800.00 |
|
| RG226633 | BCAP31 (tGFP-tagged) - Human B-cell receptor-associated protein 31 (BCAP31), transcript variant 3 |
CNY 4,000.00 |
