Enkephalin (PENK) (NM_001135690) Human Untagged Clone
CAT#: SC324869
PENK (untagged)-Human proenkephalin (PENK), transcript variant 1
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PE; PENK-A |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001135690, the custom clone sequence may differ by one or more nucleotides
ATGGCGCGGTTCCTGACACTTTGCACTTGGCTGCTGTTGCTCGGCCCCGGGCTCCTGGCGACCGTGCGGG CCGAATGCAGCCAGGATTGCGCGACGTGCAGCTACCGCCTAGTGCGCCCGGCCGACATCAACTTCCTGGC TTGCGTAATGGAATGTGAAGGTAAACTGCCTTCTCTGAAAATTTGGGAAACCTGCAAGGAGCTCCTGCAG CTGTCCAAACCAGAGCTTCCTCAAGATGGCACCAGCACCCTCAGAGAAAATAGCAAACCGGAAGAAAGCC ATTTGCTAGCCAAAAGGTATGGGGGCTTCATGAAAAGGTATGGAGGCTTCATGAAGAAAATGGATGAGCT TTATCCCATGGAGCCAGAAGAAGAGGCCAATGGAAGTGAGATCCTCGCCAAGCGGTATGGGGGCTTCATG AAGAAGGATGCAGAGGAGGACGACTCGCTGGCCAATTCCTCAGACCTGCTAAAAGAGCTTCTGGAAACAG GGGACAACCGAGAGCGTAGCCACCACCAGGATGGCAGTGATAATGAGGAAGAAGTGAGCAAGAGATATGG GGGCTTCATGAGAGGCTTAAAGAGAAGCCCCCAACTGGAAGATGAAGCCAAAGAGCTGCAGAAGCGATAT GGGGGCTTCATGAGAAGAGTAGGTCGCCCAGAGTGGTGGATGGACTACCAGAAACGGTATGGAGGTTTCC TGAAGCGCTTTGCCGAGGCTCTGCCCTCCGACGAAGAAGGCGAAAGTTACTCCAAAGAAGTTCCTGAAAT GGAAAAAAGATACGGAGGATTTATGAGATTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001135690 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135690.1, NP_001129162.1 |
RefSeq Size | 1354 bp |
RefSeq ORF | 804 bp |
Locus ID | 5179 |
UniProt ID | P01210 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the pentapeptide opioids Met-enkephalin and Leu-enkephalin, which are stored in synaptic vesicles, then released into the synapse where they bind to mu- and delta-opioid receptors to modulate the perception of pain. Other non-opioid cleavage products may function in distinct biological activities. [provided by RefSeq, Jul 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227805 | PENK (Myc-DDK-tagged)-Human proenkephalin (PENK), transcript variant 1 |
CNY 2,400.00 |
|
RC227805L3 | Lenti ORF clone of Human proenkephalin (PENK), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227805L4 | Lenti ORF clone of Human proenkephalin (PENK), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG227805 | PENK (tGFP-tagged) - Human proenkephalin (PENK), transcript variant 1 |
CNY 4,370.00 |