Sphingomyelin Synthase 2 (SGMS2) (NM_001136258) Human Untagged Clone
CAT#: SC325001
SGMS2 (untagged)-Human sphingomyelin synthase 2 (SGMS2), transcript variant 3
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDL; SMS2 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001136258 edited
ATGGATATCATAGAGACAGCAAAACTTGAAGAACATTTGGAAAATCAACCCAGTGATCCT ACGAACACTTATGCAAGACCCGCTGAACCTGTTGAAGAAGAAAACAAAAATGGCAATGGT AAACCCAAGAGCTTATCCAGTGGGCTGCGAAAAGGCACCAAAAAGTACCCGGACTATATC CAAATTGCTATGCCCACTGAATCAAGGAACAAATTTCCACTAGAGTGGTGGAAAACGGGC ATTGCCTTCATATATGCAGTTTTCAACCTCGTCTTGACAACCGTCATGATCACAGTTGTA CATGAGAGGGTCCCTCCCAAGGAGCTTAGCCCTCCACTCCCAGACAAGTTTTTTGATTAC ATTGATAGGGTGAAATGGGCATTTTCTGTATCAGAAATAAATGGGATTATATTAGTTGGA TTATGGATCACCCAGTGGCTGTTTCTGAGATACAAGTCAATAGTGGGACGCAGATTCTGT TTTATTATTGGAACTTTATACCTGTATCGCTGCATTACAATGTATGTTACTACTCTACCT GTGCCTGGAATGCATTTCCAGTGTGCTCCAAAGCTCAATGGAGACTCTCAGGCAAAAGTT CAACGGATTCTACGATTGATTTCTGGTGGTGGATTGTCCATAACTGGATCACATATCTTA TGTGGAGACTTCCTCTTCAGCGGTCACACGGTTACGCTGACACTGACTTATTTGTTCATC AAAGAATATTCGCCTCGTCACTTCTGGTGGTATCATTTAATCTGCTGGCTGCTGAGTGCT GCCGGGATCATCTGCATTCTTGTAGCACACGAACACTACACTATCGATGTGATCATTGCT TATTATATCACAACACGACTGTTTTGGTGGTACCATTCAATGGCCAATGAAAAGAACTTG AAGGTCTCTTCACAGACTAATTTCTTATCTCGAGCATGGTGGTTCCCCATCTTTTATTTT TTTGAGAAAAATGTACAAGGCTCAATTCCTTGCTGCTTCTCCTGGCCGCTGTCTTGGCCT CCTGGCTGCTTCAAATCATCATGCAAAAAGTATTCACGGGTTCAGAAGATTGGTGAAGAC AATGAGAAATCGACCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001136258 |
Insert Size | 5500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001136258.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001136258.1, NP_001129730.1 |
RefSeq Size | 6162 bp |
RefSeq ORF | 1098 bp |
Locus ID | 166929 |
UniProt ID | Q8NHU3 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Metabolic pathways, Sphingolipid metabolism |
Gene Summary | Sphingomyelin, a major component of cell and Golgi membranes, is made by the transfer of phosphocholine from phosphatidylcholine onto ceramide, with diacylglycerol as a side product. The protein encoded by this gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The synthesis is reversible, and this enzyme can catalyze the reaction in either direction. The encoded protein is required for cell growth. Three transcript variants encoding the same protein have been found for this gene. There is evidence for more variants, but the full-length nature of their transcripts has not been determined.[provided by RefSeq, Oct 2008] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All three variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227444 | SGMS2 (Myc-DDK-tagged)-Human sphingomyelin synthase 2 (SGMS2), transcript variant 3 |
CNY 3,656.00 |
|
RC227444L3 | Lenti ORF clone of Human sphingomyelin synthase 2 (SGMS2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227444L4 | Lenti ORF clone of Human sphingomyelin synthase 2 (SGMS2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG227444 | SGMS2 (tGFP-tagged) - Human sphingomyelin synthase 2 (SGMS2), transcript variant 3 |
CNY 4,370.00 |