SEC14 like protein 2 (SEC14L2) (NM_033382) Human Untagged Clone
CAT#: SC325039
SEC14L2 (untagged)-Human SEC14-like 2 (S. cerevisiae) (SEC14L2), transcript variant 2
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C22orf6; SPF; TAP; TAP1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_033382, the custom clone sequence may differ by one or more nucleotides
ATGAGCGGCAGAGTCGGCGATCTGAGCCCCAGGCAGAAGGAGGCATTGGCCAAGTTTCGG GAGAATGTCCAGGATGTGCTGCCGGCCCTGCCGAATCCAGATGACTATTTTCTCCTGCGT TGGCTCCGAGCCAGAAGCTTCGACCTGCAGAAGTCGGAGGCCATGCTCCGGAAGCATGTG GAGTTCCGAAAGCAAAAGGACATTGACAACATCATTAGCTGGCAGCCTCCAGAGGTGATC CAACAGTATCTGTCAGGGGGTATGTGTGGCTATGACCTGGATGGCTGCCCAGTCTGGTAC GACATAATTGGACCTCTGGATGCCAAGGGTCTGCTGTTCTCAGCCTCCAAACAGGACCTG CTGAGGACCAAGATGCGGGAGTGTGAGCTGCTTCTGCAAGAGTGTGCCCACCAGACCACA AAGTTGGGGAGGAAGGTGGAGACCATCACCATAATTTATGACTGCGAGGGGCTTGGCCTC AAGCATCTCTGGAAGCCTGCTGTGGAGGCCTATGGAGAGTTTCTCTGCATGTTTGAGGAA AATTATCCCGAAACACTGAAGCGTCTTTTTGTTGTTAAAGCCCCCAAACTGTTTCCTGTG GCCTATAACCTCATCAAACCCTTCCTGAGTGAGGACACTCGTAAGAAGATCATGGTCCTG GGAGCAAATTGGAAGGAGGTTTTACTGAAACATATCAGCCCTGACCAGGTGCCTGTGGAG TATGGGGGCACCATGACTGACCCTGATGGAAACCCCAAGTGCAAATCCAAGATCAACTAC GGGGGTGACATCCCCAGGAAGTATTATGTGCGAGACCAGGTGAAACAGCAGTATGAACAC AGCGTGCAGATTTCCCGTGGCTCCTCCCACCAAGTGGAGTATGAGATCCTCTTCCCTGGC TGTGTCCTCAGGTGGCAGTTTATGTCAGATGGAGCGGATGTTGGTTTTGGGATTTTCCTG AAGACCAAGATGGGAGAGAGGCAGCGGGCAGGGGAGATGACAGAGGTGCTGCCCAACCAG AGGTACAACTCCCACCTGGTCCCTGAAGATGGGACCCTCACCTGCAGTGATCCTGGCATC TGTAAGTATCTCTGCCTTGGCAATGCCTTGAAGCCCCATGTCCAGCTTTCTGCCTGTGAG GTTCCTCTTCCTCCATGGATTTTTGGCTCTGAGTGT |
Restriction Sites | Please inquire |
ACCN | NM_033382 |
Insert Size | 1845 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_033382.1, NP_203740.1 |
RefSeq Size | 1845 bp |
RefSeq ORF | 1845 bp |
Locus ID | 23541 |
UniProt ID | O76054 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a cytosolic protein which belongs to a family of lipid-binding proteins including Sec14p, alpha-tocopherol transfer protein, and cellular retinol-binding protein. The encoded protein stimulates squalene monooxygenase which is a downstream enzyme in the cholesterol biosynthetic pathway. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227259 | SEC14L2 (Myc-DDK-tagged)-Human SEC14-like 2 (S. cerevisiae) (SEC14L2), transcript variant 2 |
CNY 3,990.00 |
|
RC227259L3 | Lenti-ORF clone of SEC14L2 (Myc-DDK-tagged)-Human SEC14-like 2 (S. cerevisiae) (SEC14L2), transcript variant 2 |
CNY 5,890.00 |
|
RC227259L4 | Lenti-ORF clone of SEC14L2 (mGFP-tagged)-Human SEC14-like 2 (S. cerevisiae) (SEC14L2), transcript variant 2 |
CNY 5,890.00 |
|
RG227259 | SEC14L2 (tGFP-tagged) - Human SEC14-like 2 (S. cerevisiae) (SEC14L2), transcript variant 2 |
CNY 4,370.00 |
其它SEC14 like protein 2产品