robld3 (LAMTOR2) (NM_001145264) Human Untagged Clone
CAT#: SC325449
LAMTOR2 (untagged)-Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ENDAP; HSPC003; MAPBPIP; MAPKSP1AP; p14; Ragulator2; ROBLD3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145264, the custom clone sequence may differ by one or more nucleotides
ATGCTGCGCCCCAAGGCTTTGACCCAGGTGCTAAGCCAAGCCAACACTGGAGGCGTCCAG AGCACCCTGCTGCTGAATAACGAGGGATCACTGCTGGCCTACTCTGGTTACGGGGACACT GACGCCCGGGTCACCGCTGCCATAGCCAGTAACATCTGGGCCGCCTACGACCGGAACGGG AACCAAGCGTTTAATGAAGACAATCTCAAATTCATCCTCATGGACTGCATGGCCCAGGCT TTGGTGCAGTACCTGGAGGAGCCCCTCACCCAAGTGGCGGCATCT |
Restriction Sites | Please inquire |
ACCN | NM_001145264 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145264.1, NP_001138736.1 |
RefSeq Size | 609 bp |
RefSeq ORF | 288 bp |
Locus ID | 28956 |
UniProt ID | Q9Y2Q5 |
Gene Summary | The product of this gene is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The mouse protein interacts with MAPK scaffold protein 1, a component of the mitogen-activated protein kinase pathway. In humans, a mutation in this gene has been associated with a primary immunodeficiency syndrome, and suggests a role for this protein in endosomal biogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227003 | LAMTOR2 (Myc-DDK-tagged)-Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 2 |
CNY 3,990.00 |
|
RC227003L3 | Lenti-ORF clone of LAMTOR2 (Myc-DDK-tagged)-Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 2 |
CNY 5,890.00 |
|
RC227003L4 | Lenti-ORF clone of LAMTOR2 (mGFP-tagged)-Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 2 |
CNY 5,890.00 |
|
RG227003 | LAMTOR2 (tGFP-tagged) - Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2), transcript variant 2 |
CNY 4,370.00 |
其它LAMTOR2产品