C7orf16 (PPP1R17) (NM_001145123) Human Untagged Clone
CAT#: SC325461
PPP1R17 (untagged)-Human chromosome 7 open reading frame 16 (C7orf16), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C7orf16; GSBS |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145123, the custom clone sequence may differ by one or more nucleotides
ATGATGTCCACTGAGCAAATGCAGCCACTGGAACTCTCAGAAGACAGACTGGACAAGCTA GACCCTCGTTGCAGCCACTTAGGTGTGTTTTCAGAACATTTAATTAAAAGATACGATGTT CAAGAGAGACATCCAAAGGGCAAAATGATCCCTGTTCTTCATAACACTGACCTGGAACAG AAAAAGCCAAGGAGAAAAGACACACCTGCCCTGCACATGTCCCCCTTTGCAGCAGGTGTG ACATTGCTCAGGGACGAGAGACCCAAAGCAATCGTGGAAGATGACGAAAAGGATGGTGAC AAGATAGCTATT |
Restriction Sites | Please inquire |
ACCN | NM_001145123 |
Insert Size | 1813 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145123.1, NP_001138595.1 |
RefSeq Size | 1813 bp |
RefSeq ORF | 315 bp |
Locus ID | 10842 |
UniProt ID | O96001 |
Protein Pathways | Long-term depression |
Gene Summary | The protein encoded by this gene is found primarily in cerebellar Purkinje cells, where it functions as a protein phosphatase inhibitor. The encoded protein is a substrate for cGMP-dependent protein kinase. An allele of this gene was discovered that increases susceptibility to hypercholesterolemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) is shorter but has the identical N- and C-termini compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227886 | PPP1R17 (Myc-DDK-tagged)-Human chromosome 7 open reading frame 16 (C7orf16), transcript variant 2 |
CNY 3,990.00 |
|
RC227886L3 | Lenti-ORF clone of PPP1R17 (Myc-DDK-tagged)-Human chromosome 7 open reading frame 16 (C7orf16), transcript variant 2 |
CNY 5,890.00 |
|
RC227886L4 | Lenti-ORF clone of PPP1R17 (mGFP-tagged)-Human chromosome 7 open reading frame 16 (C7orf16), transcript variant 2 |
CNY 5,890.00 |
|
RG227886 | PPP1R17 (tGFP-tagged) - Human chromosome 7 open reading frame 16 (C7orf16), transcript variant 2 |
CNY 4,370.00 |
其它PPP1R17产品