IFI27 (NM_001130080) Human Untagged Clone
CAT#: SC325480
IFI27 (untagged)-Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 1
CNY 1,920.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FAM14D; ISG12; ISG12A; P27 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001130080, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCCTCTGCTCTCACCTCATCAGCAGTGACCAGTGTGGCCAAAGTGGTCAGGGTG GCCTCTGGCTCTGCCGTAGTTTTGCCCCTGGCCAGGATTGCTACAGTTGTGATTGGAGGA GTTGTGGCCATGGCGGCTGTGCCCATGGTGCTCAGTGCCATGGGCTTCACTGCGGCGGGA ATCGCCTCGTCCTCCATAGCAGCCAAGATGATGTCCGCGGCGGCCATTGCCAATGGGGGT GGAGTTGCCTCGGGCAGCCTTGTGGCTACTCTGCAGTCACTGGGAGCAACTGGACTCTCC GGATTGACCAAGTTCATCCTGGGCTCCATTGGGTCTGCCATTGCGGCTGTCATTGCGAGG TTCTAC |
Restriction Sites | Please inquire |
ACCN | NM_001130080 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001130080.1, NP_001123552.1 |
RefSeq Size | 665 bp |
RefSeq ORF | 369 bp |
Locus ID | 3429 |
UniProt ID | P40305 |
Protein Families | Transmembrane |
Gene Summary | Probable adapter protein involved in different biological processes (PubMed:22427340, PubMed:27194766). Part of the signaling pathways that lead to apoptosis (PubMed:18330707, PubMed:27673746, PubMed:24970806). Involved in type-I interferon-induced apoptosis characterized by a rapid and robust release of cytochrome C from the mitochondria and activation of BAX and caspases 2, 3, 6, 8 and 9 (PubMed:18330707, PubMed:27673746). Also functions in TNFSF10-induced apoptosis (PubMed:24970806). May also have a function in the nucleus, where it may be involved in the interferon-induced negative regulation of the transcriptional activity of NR4A1, NR4A2 and NR4A3 through the enhancement of XPO1-mediated nuclear export of these nuclear receptors (PubMed:22427340). May thereby play a role in the vascular response to injury (By similarity). In the innate immune response, has an antiviral activity towards hepatitis C virus/HCV (PubMed:27194766, PubMed:27777077). May prevent the replication of the virus by recruiting both the hepatitis C virus non-structural protein 5A/NS5A and the ubiquitination machinery via SKP2, promoting the ubiquitin-mediated proteasomal degradation of NS5A (PubMed:27194766, PubMed:27777077).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). This variant represents an allele commonly found in the human population and corresponds to the allele present in the GRC reference assembly. Variants 1, 3, 5, 11 and 12 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225064 | IFI27 (Myc-DDK-tagged)-Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 1 |
CNY 1,920.00 |
|
RC225064L3 | Lenti-ORF clone of IFI27 (Myc-DDK-tagged)-Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 1 |
CNY 5,890.00 |
|
RC225064L4 | Lenti-ORF clone of IFI27 (mGFP-tagged)-Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 1 |
CNY 4,320.00 |
|
RG225064 | IFI27 (tGFP-tagged) - Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 1 |
CNY 4,370.00 |