SNX3 (NM_152827) Human Untagged Clone
CAT#: SC325493
SNX3 (untagged)-Human sorting nexin 3 (SNX3), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Grd19; MCOPS8; SDP3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_152827 edited
ATGGCGGAGACCGTGGCTGACACCCGGCGGCTGATCACCAAGCCGCAGAACCTGAATGAC GCCTACGGACCCCCCAGCAACTTCCTCGAGATCGATGTGAGCAACCCGCAAACGGTGGGG GTCGGCCGGGGCCGCTTCACCACTTACGAAATCAGGGTCAAGGTCGTAGTTCCCCCGCTC CCTGGGAAAGCGTTTTTGCGTCAGCTTCCTTTTAGAGGAGATGATGGAATATTTGATGAC AATTTTATTGAGGAAAGAAAACAAGGGCTGGAGCAGTTTATAAACAAGGTCGCTGGTCAT CCTCTGGCACAGAACGAACGTTGTCTTCACATGTTTTTACAAGATGAAATAATAGATAAA AGCTATACTCCATCTAAAATAAGACATGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_152827 |
Insert Size | 750 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_152827.2, NP_690040.1 |
RefSeq Size | 1401 bp |
RefSeq ORF | 393 bp |
Locus ID | 8724 |
UniProt ID | O60493 |
Gene Summary | This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like most family members. This protein interacts with phosphatidylinositol-3-phosphate, and is involved in protein trafficking. A pseudogene of this gene is present on the sex chromosomes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) lacks an in-frame coding exon, compared to variant 1. It encodes isoform b, also known as SNX3A, which is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227550 | SNX3 (Myc-DDK-tagged)-Human sorting nexin 3 (SNX3), transcript variant 2 |
CNY 3,990.00 |
|
RC227550L3 | Lenti-ORF clone of SNX3 (Myc-DDK-tagged)-Human sorting nexin 3 (SNX3), transcript variant 2 |
CNY 5,890.00 |
|
RC227550L4 | Lenti-ORF clone of SNX3 (mGFP-tagged)-Human sorting nexin 3 (SNX3), transcript variant 2 |
CNY 5,890.00 |
|
RG227550 | SNX3 (tGFP-tagged) - Human sorting nexin 3 (SNX3), transcript variant 2 |
CNY 4,370.00 |