United States
Germany
Japan
United Kingdom
China
NKIRAS2 (NM_001144928) Human Untagged Clone
CAT＃: SC325500
NKIRAS2 (untagged)-Human NFKB inhibitor interacting Ras-like 2 (NKIRAS2), transcript variant 4
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | kappaB-Ras2; KBRAS2 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001144928, the custom clone sequence may differ by one or more nucleotides
ATGGGGAAGAGCTGCAAGGTGGTCGTGTGTGGCCAGGCGTCTGTGGGCAAAACTTCAATC CTGGAGCAGCTTCTGTATGGGAACCATGTAGTGGGTTCGGAGATGATCGAGACGCAGGAG GACATCTACGTGGGCTCCATTGAGACAGACCGGGGGGTGCGAGAGCAGGTCACCATCGTG GTCCTTGGCAACAAGTGTGACTTACAGGAGCAGCGGCGTGTAGACCCAGATGTGGCTCAG CACTGGGCCAAGTCAGAGAAGGTGAAGCTGTGGGAGGTGTCAGTGGCGGACCGGCGCTCC CTCCTGGAGCCCTTTGTCTACTTGGCCAGCAAGATGACGCAACCCCAGAGCAAGTCTGCC TTCCCCCTCAGCCGGAAGAACAAGGGCAGCGGCTCCTTGGATGGC |
| Restriction Sites | Please inquire |
| ACCN | NM_001144928 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001144928.1, NP_001138400.1 |
| RefSeq Size | 2306 bp |
| RefSeq ORF | 408 bp |
| Locus ID | 28511 |
| UniProt ID | Q9NYR9 |
| Gene Summary | Atypical Ras-like protein that acts as a potent regulator of NF-kappa-B activity by preventing the degradation of NF-kappa-B inhibitor beta (NFKBIB) by most signals, explaining why NFKBIB is more resistant to degradation. May act by blocking phosphorylation of NFKBIB and nuclear localization of p65/RELA NF-kappa-B subunit. It is unclear whether it acts as a GTPase. Both GTP- and GDP-bound forms block phosphorylation of NFKBIB (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 5' UTR and lacks an in-frame segment of the coding region, compared to variant 1. These differences result in a shorter protein (isoform b), compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226756 | NKIRAS2 (Myc-DDK-tagged)-Human NFKB inhibitor interacting Ras-like 2 (NKIRAS2), transcript variant 4 |
CNY 3,990.00 |
|
| RC226756L3 | Lenti-ORF clone of NKIRAS2 (Myc-DDK-tagged)-Human NFKB inhibitor interacting Ras-like 2 (NKIRAS2), transcript variant 4 |
CNY 5,890.00 |
|
| RC226756L4 | Lenti-ORF clone of NKIRAS2 (mGFP-tagged)-Human NFKB inhibitor interacting Ras-like 2 (NKIRAS2), transcript variant 4 |
CNY 5,890.00 |
|
| RG226756 | NKIRAS2 (tGFP-tagged) - Human NFKB inhibitor interacting Ras-like 2 (NKIRAS2), transcript variant 4 |
CNY 4,370.00 |
其它NKIRAS2产品
