CD164 (NM_001142404) Human Untagged Clone
CAT#: SC325529
CD164 (untagged)-Human CD164 molecule, sialomucin (CD164), transcript variant 5
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DFNA66; endolyn; MGC-24; MGC-24v; MUC-24 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325529 representing NM_001142404.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGCGGCTCTCCCGCTCACTGCTTTGGGCCGCCACCTGCCTGGGCGTGCTCTGCGTGCTGTCCGCG GACAAGAACACGACCCAGCACCCGAACGTGACGACTTTAGCGCCCATCTCCAACGTAACCTCGGCGCCG GTGACGTCCCTCCCGCTGGTCACCACTCCGGCACCAGAAACCTGTGAAGGTCGAAACAGCTGCGTTTCC TGTTTTAATGTTAGCGTTGTTAATACTACCTGCTTTTGGATAGAATGTAAAGATGAGAGCTATTGTTCA CATAACTCAACAGTTAGTGATTGTCAAGTGGGGAACACGACAGACTTCTGTTCCGTTTCCACGGCCACT CCAGTGCCAACAGCCAATTCTACAGCTAAACCCACAGTTCAGCCCTCCCCTTCTACAACTTCCAAGACA GTTACTACATCAGAAATAAGATGCCACACAAGGAACTACATTCCAGATTTAAAGAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142404 |
Insert Size | 474 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142404.1 |
RefSeq Size | 2429 bp |
RefSeq ORF | 474 bp |
Locus ID | 8763 |
UniProt ID | Q04900 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Lysosome |
MW | 16.7 kDa |
Gene Summary | This gene encodes a transmembrane sialomucin and cell adhesion molecule that regulates the proliferation, adhesion and migration of hematopoietic progenitor cells. The encoded protein also interacts with the C-X-C chemokine receptor type 4 and may regulate muscle development. Elevated expression of this gene has been observed in human patients with Sezary syndrome, a type of blood cancer, and a mutation in this gene may be associated with impaired hearing. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (5) uses an alternate splice site in the 3' coding region, compared to variant 1. It encodes isoform 5 which is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227018 | CD164 (Myc-DDK-tagged)-Human CD164 molecule, sialomucin (CD164), transcript variant 5 |
CNY 1,200.00 |
|
RC227018L3 | Lenti ORF clone of Human CD164 molecule, sialomucin (CD164), transcript variant 5, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227018L4 | Lenti ORF clone of Human CD164 molecule, sialomucin (CD164), transcript variant 5, mGFP tagged |
CNY 5,890.00 |
|
RG227018 | CD164 (tGFP-tagged) - Human CD164 molecule, sialomucin (CD164), transcript variant 5 |
CNY 4,370.00 |