FABP6 (NM_001130958) Human Untagged Clone
CAT#: SC325560
FABP6 (untagged)-Human fatty acid binding protein 6, ileal (FABP6), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | I-15P; I-BABP; I-BALB; I-BAP; ILBP; ILBP3; ILLBP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001130958, the custom clone sequence may differ by one or more nucleotides
ATGAAGACAGTGACGATGATGATGGTGGTGGAGATGCAGGCGCTGACTCAGGTTCTGAGA GCTGTGTTGTCTGCGTGCACATGGGTGAGCCGGAAAGGAGACCTGCAGAGAATGAAACAG ACACATAAAGGAAAGCCTCCCAGCAGCATGGCTTTCACCGGCAAGTTCGAGATGGAGAGT GAGAAGAATTATGATGAGTTCATGAAGCTCCTTGGGATCTCCAGCGATGTAATCGAAAAG GCCCGCAACTTCAAGATCGTCACGGAGGTGCAGCAGGATGGGCAGGACTTCACTTGGTCC CAGCACTACTCCGGGGGCCACACCATGACCAACAAGTTCACTGTTGGCAAGGAAAGCAAC ATACAGACAATGGGGGGCAAGACGTTCAAGGCCACTGTGCAGATGGAGGGCGGGAAGCTG GTGGTGAATTTCCCCAACTATCACCAGACCTCAGAGATCGTGGGTGACAAGCTGGTGGAG GTCTCCACCATCGGAGGCGTGACCTATGAGCGCGTGAGCAAGAGACTGGCC |
Restriction Sites | Please inquire |
ACCN | NM_001130958 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001130958.1, NP_001124430.1 |
RefSeq Size | 752 bp |
RefSeq ORF | 534 bp |
Locus ID | 2172 |
UniProt ID | P51161 |
Protein Pathways | PPAR signaling pathway |
Gene Summary | This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) has an additional 5' exon, as compared to variant 1. Both variants 1 and 3 encode the same isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225187 | FABP6 (Myc-DDK-tagged)-Human fatty acid binding protein 6, ileal (FABP6), transcript variant 3 |
CNY 3,990.00 |
|
RC225187L3 | Lenti-ORF clone of FABP6 (Myc-DDK-tagged)-Human fatty acid binding protein 6, ileal (FABP6), transcript variant 3 |
CNY 5,890.00 |
|
RC225187L4 | Lenti-ORF clone of FABP6 (mGFP-tagged)-Human fatty acid binding protein 6, ileal (FABP6), transcript variant 3 |
CNY 5,890.00 |
|
RG225187 | FABP6 (tGFP-tagged) - Human fatty acid binding protein 6, ileal (FABP6), transcript variant 3 |
CNY 4,240.00 |