PPT1 (NM_001142604) Human Untagged Clone
CAT#: SC325598
PPT1 (untagged)-Human palmitoyl-protein thioesterase 1 (PPT1), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CLN1; INCL; PPT |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001142604, the custom clone sequence may differ by one or more nucleotides
GCGATCGCCATGGCGTCGCCCGGCTGCCTGTGGCTCTTGGCTGTGGCTCTCCTGCCATGGACCTGCGCTT CTCGGGCGCTGCAGCATCTGGACCCGCCGGCGCCGCTGCCGTTGGTGATCTGGCATGGGATGGGTGTTTT TGGACTCCCTCGATGCCCAGGAGAGAGCTCTCACATCTGTGACTTCATCCGAAAAACACTGAATGCTGGG GCGTACTCCAAAGTTGTTCAGGAACGCCTCGTGCAAGCCGAATACTGGCATGACCCCATAAAGGAGGATG TGTATCGCAACCACAGCATCTTCTTGGCAGATATAAATCAGGAGCGGGGTATCAATGAGTCCTACAAGAA AAACCTGATGGCCCTGAAGAAGTTTGTGATGGTGAAATTCCTCAATGATTCCATTGTGGACCCTGTAGAT TCGGAGTGGTTTGGATTTTACAGAAGTGGCCAAGCCAAGGAAACCATTCCCTTACAGGAGACCTCCCTGT ACACACAGGACCGCCTGGGGCTAAAGGAAATGGACAATGCAGGACAGCTAGTGTTTCTGGCTACAGAAGG GGACCATCTTCAGTTGTCTGAAGAATGGTTTTATGCCCACATCATACCATTCCTTGGATGAACGCGT |
Restriction Sites | Please inquire |
ACCN | NM_001142604 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142604.1, NP_001136076.1 |
RefSeq Size | 2195 bp |
RefSeq ORF | 612 bp |
Locus ID | 5538 |
UniProt ID | P50897 |
Protein Families | Druggable Genome |
Protein Pathways | Fatty acid elongation in mitochondria, Lysosome, Metabolic pathways |
Gene Summary | The protein encoded by this gene is a small glycoprotein involved in the catabolism of lipid-modified proteins during lysosomal degradation. The encoded enzyme removes thioester-linked fatty acyl groups such as palmitate from cysteine residues. Defects in this gene are a cause of infantile neuronal ceroid lipofuscinosis 1 (CLN1, or INCL) and neuronal ceroid lipofuscinosis 4 (CLN4). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2008] Transcript Variant: This variant (2) lacks an in-frame segment compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227286 | PPT1 (Myc-DDK-tagged)-Human palmitoyl-protein thioesterase 1 (PPT1), transcript variant 2 |
CNY 2,400.00 |
|
RC227286L3 | Lenti ORF clone of Human palmitoyl-protein thioesterase 1 (PPT1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227286L4 | Lenti ORF clone of Human palmitoyl-protein thioesterase 1 (PPT1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG227286 | PPT1 (tGFP-tagged) - Human palmitoyl-protein thioesterase 1 (PPT1), transcript variant 2 |
CNY 4,370.00 |