PPT1 (NM_001142604) Human Untagged Clone

CAT#: SC325598

PPT1 (untagged)-Human palmitoyl-protein thioesterase 1 (PPT1), transcript variant 2



  "NM_001142604" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
PPT1 mouse monoclonal antibody, clone OTI1F10 (formerly 1F10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CLN1; INCL; PPT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001142604, the custom clone sequence may differ by one or more nucleotides


GCGATCGCCATGGCGTCGCCCGGCTGCCTGTGGCTCTTGGCTGTGGCTCTCCTGCCATGGACCTGCGCTT
CTCGGGCGCTGCAGCATCTGGACCCGCCGGCGCCGCTGCCGTTGGTGATCTGGCATGGGATGGGTGTTTT
TGGACTCCCTCGATGCCCAGGAGAGAGCTCTCACATCTGTGACTTCATCCGAAAAACACTGAATGCTGGG
GCGTACTCCAAAGTTGTTCAGGAACGCCTCGTGCAAGCCGAATACTGGCATGACCCCATAAAGGAGGATG
TGTATCGCAACCACAGCATCTTCTTGGCAGATATAAATCAGGAGCGGGGTATCAATGAGTCCTACAAGAA
AAACCTGATGGCCCTGAAGAAGTTTGTGATGGTGAAATTCCTCAATGATTCCATTGTGGACCCTGTAGAT
TCGGAGTGGTTTGGATTTTACAGAAGTGGCCAAGCCAAGGAAACCATTCCCTTACAGGAGACCTCCCTGT
ACACACAGGACCGCCTGGGGCTAAAGGAAATGGACAATGCAGGACAGCTAGTGTTTCTGGCTACAGAAGG
GGACCATCTTCAGTTGTCTGAAGAATGGTTTTATGCCCACATCATACCATTCCTTGGATGAACGCGT


Restriction Sites Please inquire     
ACCN NM_001142604
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142604.1, NP_001136076.1
RefSeq Size 2195 bp
RefSeq ORF 612 bp
Locus ID 5538
UniProt ID P50897
Protein Families Druggable Genome
Protein Pathways Fatty acid elongation in mitochondria, Lysosome, Metabolic pathways
Gene Summary The protein encoded by this gene is a small glycoprotein involved in the catabolism of lipid-modified proteins during lysosomal degradation. The encoded enzyme removes thioester-linked fatty acyl groups such as palmitate from cysteine residues. Defects in this gene are a cause of infantile neuronal ceroid lipofuscinosis 1 (CLN1, or INCL) and neuronal ceroid lipofuscinosis 4 (CLN4). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2008]
Transcript Variant: This variant (2) lacks an in-frame segment compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...