CEP27 (HAUS2) (NM_001130447) Human Untagged Clone
CAT#: SC325601
HAUS2 (untagged)-Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C15orf25; CEP27; HsT17025 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325601 representing NM_001130447.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGCTGCCAACCCGTGGGACCCGGCGTCCGCGCCTAACGGCGCTGGGCTAGTGCTAGGCCACTTC ATAGCTTCGGGGATGGTCAATCAGAAAAACCTGGAAATTGAACTCCTGAAACTAGAAAAAGATACAGCA GATGTTGTTCATCCTTTCTTTTTGGCTCAGAAGTGTCATACTCTGCAAAGCATGAATAATCATTTGGAA GCAGTGCTGAAAGAGAAGAGATCCCTTAGGCAAAGACTGTTGAAACCCATGTGCCAGGAAAACTTACCT ATTGAAGCTGTTTATCACAGATATATGGTACATTTGCTGGAGTTGGCTGTGACTTTCATTGAGAGATTA GAAACCCACCTTGAAACAATTAGAAATATTCCTCATTTAGCTGCAAATCTAAAGAAAATGAACCAGGCT TTAGCAAAGATGGATATATTGGTGACTGAGACAGAAGAACTGGCAGAGAATATACTCAAGTGGCGTAAA CAACAAAACGAAGTTTCGTCTTGTATCCCCAAAATATTAGCTGAAGAAAGTTATCTTTATAAACATGAT ATTATAATGCCTCCTTTACCTTTTACTTCTAAAGTTCATGTCCAAACTATTAATGCCAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001130447 |
Insert Size | 615 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001130447.1 |
RefSeq Size | 3860 bp |
RefSeq ORF | 615 bp |
Locus ID | 55142 |
UniProt ID | Q9NVX0 |
MW | 23.3 kDa |
Gene Summary | The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. [provided by RefSeq, Apr 2016] Transcript Variant: This variant (2) lacks an alternate, in-frame, segment in the CDS, compared to variant 1. The resulting protein (isoform 2) is shorter when it is compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225232 | HAUS2 (Myc-DDK-tagged)-Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 2 |
CNY 2,400.00 |
|
RC225232L3 | Lenti ORF clone of Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225232L4 | Lenti ORF clone of Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225232 | HAUS2 (tGFP-tagged) - Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 2 |
CNY 4,370.00 |