DOK3 (NM_001144876) Human Untagged Clone
CAT#: SC325634
DOK3 (untagged)-Human docking protein 3 (DOK3), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DOKL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325634 representing NM_001144876.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACCCTCTGGAGACCCCTATCAAGGATGGCATCCTCTACCAGCAGCATGTCAAGTTTGGCAAGGGG ACAGGGGAGGCCTCCTCAGGATCCACAGATGCCCAGTCTCCCAAGAGGGGCCTGGTCCCCATGGAGGAA AACTCCATCTACTCCTCCTGGCAGGAAGTGGGCGAGTTTCCCGTGGTGGTGCAGAGGACTGAGGCCGCC ACCCGCTGCCAGCTGAAGGGGCCGGCCCTGCTGGTGCTGGGCCCAGACGCCATCCAGCTGAGGGAGGCC AAGGGCACCCAGGCCCTCTACAGCTGGCCCTACCACTTCCTGCGCAAGTTCGGCTCCGACAAGATACTT CTGGGAACCCCAGGCGTCAGTCTCCTCATCTGTAAAGGAGAGAGAACCGATGACGTATCAGGCATAATC CTTGATGAGAGTTTGCTGCGTGCCTACTCAGTGCCAGGCGCTGGGGGACACAGCCGTGTTCAGGACAGC CTTGGTCCTGTTCTCCGGGAGCCGACATTCCAGGGGGAGAGAAGTTTCCTGAAGACTTCCATGCTGCGT TCCCTCCTCTGCTCCTGCTCCTGGCGCCATCCTAGGAGCCAGCCACGCACGCAAGCGTCATGCCTCCAG GGCTCTGACTGCCCAGCCCCTCACCGCAACTCCACCTCAGCTGCACACACCCTTGGCACATCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001144876 |
Insert Size | 687 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001144876.1 |
RefSeq Size | 2130 bp |
RefSeq ORF | 687 bp |
Locus ID | 79930 |
UniProt ID | Q7L591 |
Protein Families | Druggable Genome |
MW | 24.7 kDa |
Gene Summary | DOK proteins are enzymatically inert adaptor or scaffolding proteins. They provide a docking platform for the assembly of multimolecular signaling complexes. DOK3 is a negative regulator of JNK signaling in B-cells through interaction with INPP5D/SHIP1. May modulate ABL1 function (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) contains both alternate 5' and 3' terminal exons and lacks an internal in-frame exon, and it thus initiates translation at a downstream in-frame start codon, and differs in both UTRs and the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter at the N-terminus, lacks an internal segment, and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227453 | DOK3 (Myc-DDK-tagged)-Human docking protein 3 (DOK3), transcript variant 3 |
CNY 2,400.00 |
|
RC227453L3 | Lenti ORF clone of Human docking protein 3 (DOK3), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227453L4 | Lenti ORF clone of Human docking protein 3 (DOK3), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG227453 | DOK3 (tGFP-tagged) - Human docking protein 3 (DOK3), transcript variant 3 |
CNY 4,370.00 |