STOML3 (NM_001144033) Human Untagged Clone

CAT#: SC325707

STOML3 (untagged)-Human stomatin (EPB72)-like 3 (STOML3), transcript variant 2



  "NM_001144033" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal STOML3 Antibody
    • 100 ug

CNY 5,302.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Epb7.2l; SRO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325707 representing NM_001144033.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACTCCAGAGGCGAGCTTGTAGGTGTCAACAATAAACGGCTTGGTGTATGTGGCTGGATCCTGTTT
TCCCTCTCTTTCCTGTTGGTGATCATTACCTTCCCCATCTCCATATGGATGTGCTTGAAGATCATTAAG
GAGTATGAACGTGCTGTTGTATTCCGTCTGGGACGCATCCAAGCTGACAAAGCCAAGGGGCCAGGTTTG
ATCCTGGTCCTGCCATGCATAGATGTGTTTGTCAAAGTTGACCTCCGAACAGTTACTTGCAACATTCCT
CCACAAGAGATCCTCACCAGAGACTCCGTAACTACTCAGGTAGATGGAGTTGTCTATTACAGAATCTAT
AGTGCTGTCTCAGCAGTGGCTAATGTCAACGATGTCCATCAAGCAACATTTCTGCTGGCTCAAACCACT
CTGAGAAATGTCTTAGGGACACAGACCTTGTCCCAGATCTTAGCTGGACGAGAAGAGATCGCCCATAGC
ATCCAGACTTTACTTGATGATGCCACCGAACTGTGGGGGATCCGGGTGGCCCGAGTGGAAATCAAAGAT
GTTCGGATTCCCGTGCAGTTGCAGAGATCCATGGCAGCCGAGGCTGAGGCCACCCGGGAAGCGAGAGCC
AAGGTCCTTGCAGCTGAAGGAGAAATGAATGCTTCCAAATCCCTGAAGTCAGCCTCCATGGTGCTGGCT
GAGTCTCCCATAGCTCTCCAGCTGCGCTACCTGCAGACCTTGAGCACGGTAGCCACCGAGAAGAATTCT
ACGATTGTGTTTCCTCTGCCCATGAATATACTAGAGGGCATTGGTGGCGTCAGCTATGATAACCACAAG
AAGCTTCCAAATAAAGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001144033
Insert Size 849 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001144033.1
RefSeq Size 2020 bp
RefSeq ORF 849 bp
Locus ID 161003
UniProt ID Q8TAV4
Protein Families Transmembrane
MW 31 kDa
Gene Summary Required for the function of many mechanoreceptors. Modulate mechanotransduction channels and acid-sensing ion channels (ASIC) proteins. Potentiates PIEZO1 and PIEZO2 function by increasing their sensitivity to mechanical stimulations.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an additional in-frame coding exon compared to transcript variant 1. This results in translation initiation from a downstream AUG found in this novel exon, and a shorter isoform (2) with a distinct N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...