PSD93 (DLG2) (NM_001142702) Human Untagged Clone

CAT#: SC325784

DLG2 (untagged)-Human discs, large homolog 2 (Drosophila) (DLG2), transcript variant 4



  "NM_001142702" in other vectors (4)

CNY 3,656.00

CNY 5,420.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DLG2 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms chapsyn-110; PPP1R58; PSD-93; PSD93
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325784 representing NM_001142702.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGAACCACAGCATGAGCTCCGGGTCCGGATCCCTGCGAACCAATCAGAAACGCTCCCTCTACGTC
AGAGCCATGTTCGACTACGACAAGAGCAAGGACAGTGGGCTGCCAAGTCAAGGACTTAGTTTTAAATAT
GGAGATATTCTCCACGTTATCAATGCCTCTGATGATGAGTGGTGGCAAGCCAGGAGAGTCATGCTGGAG
GGAGACAGTGAGGAGATGGGGGTCATCCCCAGCAAAAGGAGGGTGGAAAGAAAGGAACGTGCCCGATTG
AAGACAGTGAAGTTTAATGCCAAACCTGGAGTGATTGATTCGAAAGGGGACATCCCCGGATTAGGTGAC
GACGGTTATGGAACAAAGACTCTGAGAGGACAAGAAGACCTCATTCTTTCCTATGAGCCTGTTACAAGG
CAGGAAATAAACTACACCCGGCCGGTGATTATCCTGGGGCCCATGAAGGATCGGATCAATGACGACTTG
ATATCTGAATTCCCTGATAAATTTGGCTCCTGTGTGCCTCATACTACGAGGCCAAAGCGAGACTACGAG
GTGGATGGCAGAGACTATCACTTTGTCATTTCCAGAGAACAAATGGAGAAAGATATCCAAGAGCACAAG
TTTATAGAAGCCGGCCAGTACAATGACAATTTATATGGAACCAGTGTGCAGTCTGTGAGATTTGTAGCA
GAAAGAGGCAAACACTGTATACTTGATGTATCAGGAAATGCTATCAAGCGGTTACAAGTTGCCCAGCTC
TATCCCATTGCCATCTTCATAAAACCCAGGTCTCTGGAACCTCTTATGGAGATGAATAAGCGTCTAACA
GAGGAACAAGCCAAGAAAACCTATGATCGAGCAATTAAGCTAGAACAAGAATTTGGAGAATATTTTACA
GCTATTGTCCAAGGAGATACTTTAGAAGATATATATAACCAATGCAAGCTTGTTATTGAAGAGCAATCT
GGGCCTTTCATCTGGATTCCCTCAAAGGAAAAGTTATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142702
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142702.1
RefSeq Size 6138 bp
RefSeq ORF 1005 bp
Locus ID 1740
UniProt ID Q15700
Protein Families Druggable Genome
MW 38.4 kDa
Gene Summary This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. The encoded protein forms a heterodimer with a related family member that may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described, but their full-length nature is not known. [provided by RefSeq, Dec 2008]
Transcript Variant: This variant (4) uses a distinct 5' UTR, lacks an in-frame portion of the 5' coding region, and uses an alternate splice pattern in the central coding region, compared to variant 1. The resulting isoform (4) has a shorter N-terminus and differs at an internal segment, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...