ETS1 (NM_001143820) Human Untagged Clone
CAT#: SC325981
ETS1 (untagged)-Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1
CNY 5,488.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | c-ets-1; ETS-1; EWSR2; p54 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001143820 edited
ATGAGCTACTTTGTGGATTCTGCTGGGAGCAGCCCCGTCCCTTACTCAGCGCCTCGTCCT GCAGTGGTGAGGCAAGGACCTAGCAACACTTATGAAGATCCTCGAATGAACTGTGGTTTC CAGTCCAATTATCACCAGCAAAGACCTTGCTACCCCTTTTGGGATGAGATGGCAACTCAG GAAGTTCCTACTGGTCTTGAACACTGTGTCTCAGATATGGAATGTGCAGATGTCCCACTA TTAACTCCAAGCAGCAAAGAAATGATGTCTCAAGCATTAAAAGCTACTTTCAGTGGTTTC ACTAAAGAACAGCAACGACTGGGGATCCCAAAAGACCCCCGGCAGTGGACAGAAACCCAT GTTCGGGACTGGGTGATGTGGGCTGTGAATGAATTCAGCCTGAAAGGTGTAGACTTCCAG AAGTTCTGTATGAATGGAGCAGCCCTCTGCGCCCTGGGTAAAGACTGCTTTCTCGAGCTG GCCCCAGACTTTGTTGGGGACATCTTATGGGAACATCTAGAGATCCTGCAGAAAGAGGAT GTGAAACCATATCAAGTTAATGGAGTCAACCCAGCCTATCCAGAATCCCGCTATACCTCG GATTACTTCATTAGCTATGGTATTGAGCATGCCCAGTGTGTTCCACCATCGGAGTTCTCA GAGCCCAGCTTCATCACAGAGTCCTATCAGACGCTCCATCCCATCAGCTCGGAAGAGCTC CTCTCCCTCAAGTATGAGAATGACTACCCCTCGGTCATTCTCCGAGACCCTCTCCAGACA GACACCTTGCAGAATGACTACTTTGCTATCAAACAAGAAGTCGTCACCCCAGACAACATG TGCATGGGGAGGACCAGTCGTGGTAAACTCGGGGGCCAGGACTCTTTTGAAAGCATAGAG AGCTACGATAGTTGTGATCGCCTCACCCAGTCCTGGAGCAGCCAGTCATCTTTCAACAGC CTGCAGCGTGTTCCCTCCTATGACAGCTTCGACTCAGAGGACTATCCGGCTGCCCTGCCC AACCACAAGCCCAAGGGCACCTTCAAGGACTATGTGCGGGACCGTGCTGACCTCAATAAG GACAAGCCTGTCATTCCTGCTGCTGCCCTAGCTGGCTACACAGGCAGTGGACCAATCCAG CTATGGCAGTTTCTTCTGGAATTACTCACTGATAAATCCTGTCAGTCTTTTATCAGCTGG ACAGGAGATGGCTGGGAATTCAAACTTTCTGACCCAGATGAGGTGGCCAGGAGATGGGGA AAGAGGAAAAACAAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTACGCTACTAT TACGACAAAAACATCATCCACAAGACAGCGGGGAAACGCTACGTGTACCGCTTTGTGTGT GACCTGCAGAGCCTGCTGGGGTACACCCCTGAGGAGCTGCACGCCATGCTGGACGTCAAG CCAGATGCCGACGAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001143820 |
Insert Size | 5100 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001143820.1, NP_001137292.1 |
RefSeq Size | 5143 bp |
RefSeq ORF | 1458 bp |
Locus ID | 2113 |
UniProt ID | P14921 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Dorso-ventral axis formation, Pathways in cancer, Renal cell carcinoma |
Gene Summary | This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Ets1 identified as a novel molecular target of RNA aptamer selected against metastatic cells for targeted delivery of nano-formulation
,Kaur, J;Tikoo, K;,
Oncogene
,PubMed ID 25639877
[ETS1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227466 | ETS1 (Myc-DDK-tagged)-Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1 |
CNY 5,488.00 |
|
RC227466L1 | Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC227466L2 | Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RC227466L3 | Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC227466L4 | Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RG227466 | ETS1 (tGFP-tagged) - Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1 |
CNY 7,088.00 |