REEP1 (NM_001164732) Human Untagged Clone
CAT#: SC326717
REEP1 (untagged)-Human receptor accessory protein 1 (REEP1) nuclear gene encoding mitochondrial protein transcript variant 4
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C2orf23; HMN5B; SPG31; Yip2a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326717 representing NM_001164732.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGTCATGGATCATCTCCAGGCTGGTGGTGCTTATATTTGGCACCCTTTACCCTGCGTATTATTCC TACAAGGCTGTGAAATCAAAGGACATTAAGGAATATGTCAAATGGATGATGTACTGGATTATATTTGCA CTTTTCACCACAGCAGAGACATTCACAGACATCTTCCTTTGTTGGGACAGGGTGCCTTATCGGAGAGAC TGCGGAGCTTCAGCATGCAGGACCTCACCACCATCAGGGGAGACGGCGCCCCTGCTCCCTCGGGCCCCC CACCACCGGGGTCTGGGCGGGCCAGCGGCAAACACGGCCAGCCTAAGATGTCCAGGAGTGCTTCTGAGA GCGCTAGCAGCTCAGGCACCGCCTAGAATCCTTCGATCTCGCTTCAGGAAGAAAAGTACCTCATCCTCG GCCACCGAAACCACGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001164732 |
Insert Size | 432 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164732.1 |
RefSeq Size | 3633 bp |
RefSeq ORF | 432 bp |
Locus ID | 65055 |
UniProt ID | Q9H902 |
Protein Families | Druggable Genome, Transmembrane |
MW | 16 kDa |
Gene Summary | This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, and lacks two alternate exons in the central coding region that causes a frameshift, compared to variant 1. The encoded isoform (4) has distinct N- and C-termini and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228082 | REEP1 (Myc-DDK-tagged)-Human receptor accessory protein 1 (REEP1), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 1,200.00 |
|
RC228082L3 | Lenti ORF clone of Human receptor accessory protein 1 (REEP1), nuclear gene encoding mitochondrial protein, transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228082L4 | Lenti ORF clone of Human receptor accessory protein 1 (REEP1), nuclear gene encoding mitochondrial protein, transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RG228082 | REEP1 (tGFP-tagged) - Human receptor accessory protein 1 (REEP1), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 4,370.00 |