SPINT2 (NM_001166103) Human Untagged Clone
CAT#: SC326762
SPINT2 (untagged)-Human serine peptidase inhibitor Kunitz type 2 (SPINT2) transcript variant b
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DIAR3; HAI-2; HAI2; Kop; PB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326762 representing NM_001166103.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGCAGCTGTGCGGGCTGAGGCGGAGCCGGGCGTTTCTCGCCCTGCTGGGATCGCTGCTCCTCTCT GGGGTCCTGGCGGCCGACCGAGAACGCAGCATCCACGAGAATGCCACGGGTGACCTGGCCACCAGCAGG AATGCAGCGGATTCCTCTGTCCCAAGTGCTCCCAGAAGGCAGGATTCTGAAGACCACTCCAGCGATATG TTCAACTATGAAGAATACTGCACCGCCAACGCAGTCACTGGGCCTTGCCGTGCATCCTTCCCACGCTGG TACTTTGACGTGGAGAGGAACTCCTGCAATAACTTCATCTATGGAGGCTGCCGGGGCAATAAGAACAGC TACCGCTCTGAGGAGGCCTGCATGCTCCGCTGCTTCCGCCAGCAGGAGAATCCTCCCCTGCCCCTTGGC TCAAAGGTGGTGGTTCTGGCGGGGCTGTTCGTGATGGTGTTGATCCTCTTCCTGGGAGCCTCCATGGTC TACCTGATCCGGGTGGCACGGAGGAACCAGGAGCGTGCCCTGCGCACCGTCTGGAGCTCCGGAGATGAC AAGGAGCAGCTGGTGAAGAACACATATGTCCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166103 |
Insert Size | 588 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001166103.1 |
RefSeq Size | 1646 bp |
RefSeq ORF | 588 bp |
Locus ID | 10653 |
UniProt ID | O43291 |
Protein Families | Transmembrane |
MW | 21.8 kDa |
Gene Summary | This gene encodes a transmembrane protein with two extracellular Kunitz domains that inhibits a variety of serine proteases. The protein inhibits HGF activator which prevents the formation of active hepatocyte growth factor. This gene is a putative tumor suppressor, and mutations in this gene result in congenital sodium diarrhea. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (b) lacks an alternate in-frame exon in the 5' coding region, compared to variant a. The resulting isoform (b) lacks an internal segment near the N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228127 | SPINT2 (Myc-DDK-tagged)-Human serine peptidase inhibitor, Kunitz type, 2 (SPINT2), transcript variant b |
CNY 3,600.00 |
|
RC228127L3 | Lenti ORF clone of Human serine peptidase inhibitor, Kunitz type, 2 (SPINT2), transcript variant b, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228127L4 | Lenti ORF clone of Human serine peptidase inhibitor, Kunitz type, 2 (SPINT2), transcript variant b, mGFP tagged |
CNY 5,890.00 |
|
RG228127 | SPINT2 (tGFP-tagged) - Human serine peptidase inhibitor, Kunitz type, 2 (SPINT2), transcript variant b |
CNY 5,200.00 |