SFTPA1 (NM_001164645) Human Untagged Clone
CAT#: SC326781
SFTPA1 (untagged)-Human surfactant protein A1 (SFTPA1) transcript variant 5
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | COLEC4; PSAP; PSP-A; PSPA; SFTP1; SFTPA1B; SP-A; SP-A1; SP-A1 beta; SP-A1 delta; SP-A1 epsilon; SP-A1 gamma; SPA; SPA1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164645, the custom clone sequence may differ by one or more nucleotides
ATGAGGCCATGCCAGGTGCCAGGAGCAGCGACTGGACCCAGAGCCATGTGGCTGTGCCCT CTGGCCCTCAACCTCATCTTGATGGCAGCCTCTGGTGCTGTGTGCGAAGTGAAGGACGTT TGTGTTGGAACCCCTGGTATCCCTGGAGAGTGTGGAGAGAAGGGGGAGCCTGGCGAGAGG GGCCCTCCAGGGCTTCCAGCTCATCTAGATGAGGAGCTCCAAGCCACACTCCACGACTTT AGACATCAAATCCTGCAGACAAGGGGAGCCCTCAGTCTGCAGGGCTCCATAATGACAGTA GGAGAGAAGGTCTTCTCCAGCAATGGGCAGTCCATCACTTTTGATGCCATTCAGGAGGCA TGTGCCAGAGCAGGCGGCCGCATTGCTGTCCCAAGGAATCCAGAGGAAAATGAGGCCATT GCAAGCTTCGTGAAGAAGTACAACACATATGCCTATGTAGGCCTGACTGAGGGTCCCAGC CCTGGAGACTTCCGCTACTCAGACGGGACCCCTGTAAACTACACCAACTGGTACCGAGGG GAGCCCGCAGGTCGGGGAAAAGAGCAGTGTGTGGAGATGTACACAGATGGGCAGTGGAAT GACAGGAACTGCCTGTACTCCCGACTGACCATCTGTGAGTTC |
Restriction Sites | Please inquire |
ACCN | NM_001164645 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164645.1, NP_001158117.1 |
RefSeq Size | 2075 bp |
RefSeq ORF | 645 bp |
Locus ID | 653509 |
Gene Summary | This gene encodes a lung surfactant protein that is a member of a subfamily of C-type lectins called collectins. The encoded protein binds specific carbohydrate moieties found on lipids and on the surface of microorganisms. This protein plays an essential role in surfactant homeostasis and in the defense against respiratory pathogens. Mutations in this gene are associated with idiopathic pulmonary fibrosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010] Transcript Variant: This variant (5) differs in the 5' UTR, includes an additional segment in the 5' coding region, and lacks an in-frame segment in the central coding region, compared to variant 1. The encoded isoform (3) is overall shorter but has a longer and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228146 | SFTPA1 (Myc-DDK-tagged)-Human surfactant protein A1 (SFTPA1), transcript variant 5 |
CNY 3,990.00 |
|
RC228146L3 | Lenti-ORF clone of SFTPA1 (Myc-DDK-tagged)-Human surfactant protein A1 (SFTPA1), transcript variant 5 |
CNY 5,890.00 |
|
RC228146L4 | Lenti-ORF clone of SFTPA1 (mGFP-tagged)-Human surfactant protein A1 (SFTPA1), transcript variant 5 |
CNY 5,890.00 |
|
RG228146 | SFTPA1 (tGFP-tagged) - Human surfactant protein A1 (SFTPA1), transcript variant 5 |
CNY 4,370.00 |