United States
Germany
Japan
United Kingdom
China
HES7 (NM_001165967) Human Untagged Clone
CAT＃: SC326798
HES7 (untagged)-Human hairy and enhancer of split 7 (Drosophila) (HES7) transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bHLHb37; SCDO4 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001165967 edited
ATGGTCACCCGGGATCGAGCTGAGAATAGGGACGGCCCCAAGATGCTCAAGCCGCTTGTG GAGAAGCGGCGCCGGGACCGCATCAACCGCAGCCTGGAAGAGCTGAGGCTGCTGCTGCTG GAGCGGACCCGGGACCAGAACCTCCGGAACCCGAAGCTGGAGAAAGCGGAGATATTGGAG TTCGCCGTGGGCTACTTGAGGGAGCGAAGCCGGGTGGAGCCCCCGGCCGCCGCGGCTCCA GGGGTTCCCCGGTCCCCAGTCCAGGACGCCGAGGCGCTCGCCAGCTGCTACTTGTCCGGT TTCCGCGAGTGCCTGCTTCGCTTGGCGGCCTTCGCGCACGACGCCAGCCCGGCCGCCCGC GCCCAGCTCTTCTCCGCGCTGCACGGCTATCTGCGCCCCAAACCGCCCCGGCCCAAGCCG GTAGATCCGAGGCCTCCAGCGCCGCGCCCATCCCTGGACCCCGCCGCACCGGCCCTTGGC CCTGCGCTGCACCAGCGCCCCCCAGTGCACCAGGGCCACCCTAGCCCGCGCTGCGCATGG TCCCCATCCCTCTGCTCCCCGCGCGCCGGGGATTCTGGCGCGCCGGCGCCCCTCACCGGA CTGCTGCCGCCGCCACCGCCGCCTCACAGACAAGACGGGGCGCCCAAGGCCCCGCTGCCC CCGCCGCCCGCTTTCTGGAGACCTTGGCCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001165967 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001165967.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001165967.1, NP_001159439.1 |
| RefSeq Size | 1699 bp |
| RefSeq ORF | 693 bp |
| Locus ID | 84667 |
| UniProt ID | F8VPC9 |
| Gene Summary | This gene encodes a member of the hairy and enhancer of split family of bHLH transcription factors. The mouse ortholog of this gene is regulated by Notch signaling. The protein functions as a transcriptional repressor, and is implicated in correct patterning of the axial skeleton. A mutation in this gene has been shown to result in spondylocostal dysostosis. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228163 | HES7 (Myc-DDK-tagged)-Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 1 |
CNY 3,990.00 |
|
| RC228163L3 | Lenti-ORF clone of HES7 (Myc-DDK-tagged)-Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 1 |
CNY 5,890.00 |
|
| RC228163L4 | Lenti-ORF clone of HES7 (mGFP-tagged)-Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 1 |
CNY 5,890.00 |
|
| RG228163 | HES7 (tGFP-tagged) - Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 1 |
CNY 4,370.00 |
