United States
Germany
Japan
United Kingdom
China
Neuroligin 4 (NLGN4Y) (NM_001164238) Human Untagged Clone
CAT＃: SC326827
NLGN4Y (untagged)-Human neuroligin 4 Y-linked (NLGN4Y) transcript variant 2
CNY 2,640.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HNL4Y |
| Vector | PCMV6-Neo |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001164238, the custom clone sequence may differ by one or more nucleotides
ATGTTGCGTCCCCAGGGACTGCTATGGCTCCCTTTGTTGTTCACCTCTGTCTGTGTCATG TTAAACTCCAATGTTCTTCTGTGGATAACTGCTCTTGCCATCAAGTTCACCCTCATTGAC AGCCAAGCACAGTATCCAGTTGTCAACACAAATTATGGTAAAATCCAGGGCCTAAGAACA CCATTACCCAGTGAGATCTTGGGTCCAGTGGAGCAGTACTTAGGGGTCCCCTATGCCTCA CCCCCAACTGGAGAGAGGCGGTTTCAGCCACCAGAATCCCCATCCTCCTGGACTGGCATC CGAAATGCTACTCAGTTTTCTGCTGTGTGCCCCCAGCACCTGGATGAAAGATTCTTATTG CATGACATGCTGCCCATCTGGTTTACCACCAGTTTGGATACTTTGATGACCTATGTTCAA GATCAAAATGAAGACTGCCTTTACTTAAACATCTATGTGCCCATGGAAGATGGAACCAAC ATAAAGAGAAATGCAGACGATATAACCAGTAATGACCATGGTGAAGATAAAGATATTCAT GAACAGAACAGTAAGAAGCCTGTTATGGTCTATATCCATGGGGGATCTTACATGGAGGGA ACCGGTAACATGATTGATGGCAGCATTTTGGCCAGCTATGGGAACGTCATCGTTATCACC ATTAACTACCGTCTGGGAATACTAGGTATGCAAGAGGCACGTTTGTGTGGGAGCTCAAAA ATGTTTAATTATTTTAAATCTCCTTTCACTAATTTAATAAATTTTTTT |
| Restriction Sites | Please inquire |
| ACCN | NM_001164238 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001164238.1, NP_001157710.1 |
| RefSeq Size | 882 bp |
| RefSeq ORF | 771 bp |
| Locus ID | 22829 |
| UniProt ID | Q8NFZ3 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a type I membrane protein that belongs to the family of neuroligins, which are cell adhesion molecules present at the postsynaptic side of the synapse, and may be essential for the formation of functional synapses. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Mar 2011] Transcript Variant: This variant (2) lacks several exons from the 3' end, and contains 2 alternate exons, including the 3' terminal exon, compared to variant 1. This results in a frame-shift, and a shorter isoform (2) with a distinct C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228192 | NLGN4Y (Myc-DDK-tagged)-Human neuroligin 4, Y-linked (NLGN4Y), transcript variant 2 |
CNY 3,990.00 |
|
| RC228192L3 | Lenti-ORF clone of NLGN4Y (Myc-DDK-tagged)-Human neuroligin 4, Y-linked (NLGN4Y), transcript variant 2 |
CNY 5,890.00 |
|
| RC228192L4 | Lenti-ORF clone of NLGN4Y (mGFP-tagged)-Human neuroligin 4, Y-linked (NLGN4Y), transcript variant 2 |
CNY 5,890.00 |
|
| RG228192 | NLGN4Y (tGFP-tagged) - Human neuroligin 4, Y-linked (NLGN4Y), transcript variant 2 |
CNY 4,370.00 |
其它Neuroligin 4产品
