CDK10 (NM_001160367) Human Untagged Clone

CAT#: SC326856

CDK10 (untagged)-Human cyclin-dependent kinase 10 (CDK10) transcript variant d



  "NM_001160367" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CDK10 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALSAS; PISSLRE
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001160367, the custom clone sequence may differ by one or more nucleotides
ATGGACAAGGAGAAGGATGGCATCCCCATCAGCAGCTTGCGGGAGATCACGCTGCTGCTC
CGCCTGCGTCATCCGAACATCGTGGAGCTGAAGGAGGTGGTTGTGGGGAACCACCTGGAG
AGCATCTTCCTGGTGATGGGTTACTGTGAGCAGGACCTGGCCAGCCTCCTGGAGAATATG
CCAACACCCTTCTCGGAGGCTCAGGTCAAGTGCATCGTGCTGCAGGTGCTCCGGGGCCTC
CAGTATCTGCACAGGAACTTCATTATCCACAGGGACCTGAAGGTTTCCAACTTGCTCATG
ACCGACAAGGGTTGTGTGAAGACAGCGGATTTCGGCCTGGCCCGGGCCTATGGTGTCCCA
GTAAAGCCAATGACCCCCAAGGTGGTCACTCTCTGGTACCGAGCCCCTGAACTGCTGTTG
GGAACCACCACGCAGACCACCAGCATCGACATGTGGGCTGTGGGCTGCATACTGGCCGAG
CTGCTGGCGCACAGGCCTCTTCTCCCCGGCACTTCCGAGATCCACCAGATCGACTTGATC
GTGCAGCTGCTGGGCACGCCCAGTGAGAACATCTGGCCGGGCTTTTCCAAGCTGCCACTG
GTCGGCCAGTACAGCCTCCGGAAGCAGCCCTACAACAACCTGAAGCACAAGTTCCCATGG
CTGTCGGAGGCCGGGCTGCGCCTGCTGCACTTCCTGTTCATGTACGACCCTAAGAAAAGG
GCGACGGCCGGGGACTGCCTGGAGAGCTCCTATTTCAAGGAGAAGCCCCTACCCTGTGAG
CCGGAGCTCATGCCGACCTTTCCCCACCACCGCAACAAGCGGGCCGCCCCAGCCACCTCC
GAGGGCCAGAGCAAGCGCTGTAAACCC
Restriction Sites Please inquire     
ACCN NM_001160367
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001160367.1, NP_001153839.1
RefSeq Size 1777 bp
RefSeq ORF 870 bp
Locus ID 8558
UniProt ID Q15131
Protein Families Druggable Genome, Protein Kinase
Gene Summary The protein encoded by this gene belongs to the CDK subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. This kinase has been shown to play a role in cellular proliferation and its function is limited to cell cycle G2-M phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Transcript Variant: This variant (d) uses an alternate donor splice site at the first exon resulting in translation from downstream start codon, compared to variant a. The resulting isoform (d) has a shorter N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...