SCOC (NM_001153446) Human Untagged Clone
CAT#: SC327365
SCOC (untagged)-Human short coiled-coil protein (SCOC) transcript variant 6
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HRIHFB2072; SCOCO; UNC-69 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327365 representing NM_001153446.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACGGGTCCAGGAAAGAGGAGGAGGAAGACAGCACATTCACCAACATTTCTCTTGCAGATGACATA GACCATTCCTCAAGAATTTTGTATCCAAGGCCCAAAAGTTTGTTACCCAAGATGATGAATGCTGACATG GATGCAGTTGATGCTGAAAATCAAGTGGAACTGGAGGAAAAAACAAGACTTATTAATCAAGTGTTGGAA CTCCAACACACACTTGAAGATCTCTCTGCAAGAGTAGATGCAGTTAAGGAAGAAAATCTGAAGCTAAAA TCAGAAAACCAAGTTCTTGGACAATATATAGAAAATCTCATGTCAGCTTCTAGTGTTTTTCAAACAACT GACACAAAAAGCAAAAGAAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001153446 |
Insert Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001153446.1 |
RefSeq Size | 1876 bp |
RefSeq ORF | 369 bp |
Locus ID | 60592 |
UniProt ID | Q9UIL1 |
MW | 13.9 kDa |
Gene Summary | This gene encodes a short coiled-coiled domain-containing protein that localizes to the Golgi apparatus. The encoded protein interacts with ADP-ribosylation factor-like proteins. Pseudogenes of this gene are found on chromosomes 1 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009] Transcript Variant: This variant (6) differs in the 5' UTR and 5' coding region, compared to variant 1, resulting in an isoform (4) with a distinct and shorter N-terminus, compared to isoform 1. Variants 4, 5 and 6 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228730 | SCOC (Myc-DDK-tagged)-Human short coiled-coil protein (SCOC), transcript variant 6 |
CNY 3,760.00 |
|
RC228730L3 | Lenti ORF clone of Human short coiled-coil protein (SCOC), transcript variant 6, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228730L4 | Lenti ORF clone of Human short coiled-coil protein (SCOC), transcript variant 6, mGFP tagged |
CNY 5,890.00 |
|
RG228730 | SCOC (tGFP-tagged) - Human short coiled-coil protein (SCOC), transcript variant 6 |
CNY 4,370.00 |