Guanylate kinase (GUK1) (NM_001159391) Human Untagged Clone
CAT#: SC327389
GUK1 (untagged)-Human guanylate kinase 1 (GUK1) transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GMK |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327389 representing NM_001159391.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACCCTGCTGAAGAGG CTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACCACGAGGAACCCGAGGCCCGGC GAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAGGTGATGCAGCGTGACATAGCAGCCGGCGAC TTCATCGAGCATGCCGAGTTCTCGGGGAACCTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAG GCCATGAACCGCATCTGTGTGCTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTG CGGCCCATCTACATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAAC ACTGAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGCAAGGAG CCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAGCTGAAGGAGGCG CTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001159391 |
Insert Size | 594 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001159391.1 |
RefSeq Size | 904 bp |
RefSeq ORF | 594 bp |
Locus ID | 2987 |
UniProt ID | Q16774 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Purine metabolism |
MW | 21.7 kDa |
Gene Summary | The protein encoded by this gene is an enzyme that catalyzes the transfer of a phosphate group from ATP to guanosine monophosphate (GMP) to form guanosine diphosphate (GDP). The encoded protein is thought to be a good target for cancer chemotherapy. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and contains an alternate coding exon in the 3' end compared to variant 5, that causes a frameshift. The resulting isoform (b) is shorter at the N-terminus and has a shorter and distinct C-terminus compared to isoform c. Variants 2, 3, and 4 all encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228754 | GUK1 (Myc-DDK-tagged)-Human guanylate kinase 1 (GUK1), transcript variant 3 |
CNY 2,400.00 |
|
RC228754L1 | Lenti ORF clone of Human guanylate kinase 1 (GUK1), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC228754L2 | Lenti ORF clone of Human guanylate kinase 1 (GUK1), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RC228754L3 | Lenti ORF clone of Human guanylate kinase 1 (GUK1), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228754L4 | Lenti ORF clone of Human guanylate kinase 1 (GUK1), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG228754 | GUK1 (tGFP-tagged) - Human guanylate kinase 1 (GUK1), transcript variant 3 |
CNY 4,370.00 |
其它Guanylate kinase产品