NAT1 (NM_001160179) Human Untagged Clone
CAT#: SC327442
NAT1 (untagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1) transcript variant 9
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AAC1; MNAT; NAT-1; NATI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327442 representing NM_001160179.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACATTGAAGCATATCTTGAAAGAATTGGCTATAAGAAGTCTAGGAACAAATTGGACTTGGAAACA TTAACTGACATTCTTCAACACCAGATCCGAGCTGTTCCCTTTGAGAACCTTAACATCCATTGTGGGGAT GCCATGGACTTAGGCTTAGAGGCCATTTTTGATCAAGTTGTGAGAAGAAATCGGGGTGGATGGTGTCTC CAGGTCAATCATCTTCTGTACTGGGCTCTGACCACTATTGGTTTTGAGACCACGATGTTGGGAGGGTAT GTTTACAGCACTCCAGCCAAAAAATACAGCACTGGCATGATTCACCTTCTCCTGCAGGTGACCATTGAT GGCAGGAACTACATTGTCGATGCTGGGTTTGGACGCTCATACCAGATGTGGCAGCCTCTGGAGTTAATT TCTGGGAAGGATCAGCCTCAGGTGCCTTGTGTCTTCCGTTTGACGGAAGAGAATGGATTCTGGTATCTA GACCAAATCAGAAGGGAACAGTACATTCCAAATGAAGAATTTCTTCATTCTGATCTCCTAGAAGACAGC AAATACCGAAAAATCTACTCCTTTACTCTTAAGCCTCGAACAATTGAAGATTTTGAGTCTATGAATACA TACCTGCAGACATCTCCATCATCTGTGTTTACTAGTAAATCATTTTGTTCCTTGCAGACCCCAGATGGG GTTCACTGTTTGGTGGGCTTCACCCTCACCCATAGGAGATTCAATTATAAGGACAATACAGATCTAATA GAGTTCAAGACTCTGAGTGAGGAAGAAATAGAAAAAGTGCTGAAAAATATATTTAATATTTCCTTGCAG AGAAAGCTTGTGCCCAAACATGGTGATAGATTTTTTACTATTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001160179 |
Insert Size | 873 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001160179.2 |
RefSeq Size | 2025 bp |
RefSeq ORF | 873 bp |
Locus ID | 9 |
UniProt ID | P18440 |
Protein Pathways | Caffeine metabolism, Drug metabolism - other enzymes, Metabolic pathways |
MW | 33.9 kDa |
Gene Summary | This gene is one of two arylamine N-acetyltransferase (NAT) genes in the human genome, and is orthologous to the mouse and rat Nat2 genes. The enzyme encoded by this gene catalyzes the transfer of an acetyl group from acetyl-CoA to various arylamine and hydrazine substrates. This enzyme helps metabolize drugs and other xenobiotics, and functions in folate catabolism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (9, also known as Type IA) has a distinct 5' UTR and represents use of an alternate promoter known as the NATa or P3 promoter, compared to variant 1. Variants 1-6 and 9 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on publications. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228807 | NAT1 (Myc-DDK-tagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 9 |
CNY 2,400.00 |
|
RC228807L3 | Lenti-ORF clone of NAT1 (Myc-DDK-tagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 9 |
CNY 5,890.00 |
|
RC228807L4 | Lenti-ORF clone of NAT1 (mGFP-tagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 9 |
CNY 5,890.00 |
|
RG228807 | NAT1 (tGFP-tagged) - Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 9 |
CNY 4,370.00 |