TCF7L2 (NM_001146284) Human Untagged Clone

CAT#: SC327541

TCF7L2 (untagged)-Human transcription factor 7-like 2 (T-cell specific HMG-box) (TCF7L2) transcript variant 4



  "NM_001146284" in other vectors (4)

CNY 7,220.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TCF7L2 Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TCF-4; TCF4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001146284, the custom clone sequence may differ by one or more nucleotides
ATGCCGCAGCTGAACGGCGGTGGAGGGGATGACCTAGGCGCCAACGACGAACTGATTTCC
TTCAAAGACGAGGGCGAACAGGAGGAGAAGAGCTCCGAAAACTCCTCGGCAGAGAGGGAT
TTAGCTGATGTCAAATCGTCTCTAGTCAATGAATCAGAAACGAATCAAAACAGCTCCTCC
GATTCCGAGGCGGAAAGACGGCCTCCGCCTCGCTCCGAAAGTTTCCGAGACAAATCCCGG
GAAAGTTTGGAAGAAGCGGCCAAGAGGCAAGATGGAGGGCTCTTTAAGGGGCCACCGTAT
CCCGGCTACCCCTTCATCATGATCCCCGACCTGACGAGCCCCTACCTCCCCAACGGATCG
CTCTCGCCCACCGCCCGAACCTATCTCCAGATGAAATGGCCACTGCTTGATGTCCAGGCA
GGGAGCCTCCAGAGTAGACAAGCCCTCAAGGATGCCCGGTCCCCATCACCGGCACACATT
GTCTCTAACAAAGTGCCAGTGGTGCAGCACCCTCACCATGTCCACCCCCTCACGCCTCTT
ATCACGTACAGCAATGAACACTTCACGCCGGGAAACCCACCTCCACACTTACCAGCCGAC
GTAGACCCCAAAACAGGAATCCCACGGCCTCCGCACCCTCCAGATATATCCCCGTATTAC
CCACTATCGCCTGGCACCGTAGGACAAATCCCCCATCCGCTAGGATGGCAAGGTCAACCA
GTGTACCCAATCACGACAGGAGGATTCAGACACCCCTACCCCACAGCTCTGACCGTCAAT
GCTTCCATGTCCAGGTTCCCTCCCCATATGGTCCCACCACATCATACGCTACACACGACG
GGCATTCCGCATCCGGCCATAGTCACACCAACAGTCAAACAGGAATCGTCCCAGAGTGAT
GTCGGCTCACTCCATAGTTCAAAGCATCAGGACTCCAAAAAGGAAGAAGAAAAGAAGAAG
CCCCACATAAAGAAACCTCTTAATGCATTCATGTTGTATATGAAGGAAATGAGAGCAAAG
GTCGTAGCTGAGTGCACGTTGAAAGAAAGCGCGGCCATCAACCAGATCCTTGGGCGGAGG
TGGCATGCACTGTCCAGAGAAGAGCAAGCGAAATACTACGAGCTGGCCCGGAAGGAGCGA
CAGCTTCATATGCAACTGTACCCCGGCTGGTCCGCGCGGGATAACTATGGAAAGAAGAAG
AAGAGGAAAAGGGACAAGCAGCCGGGAGAGACCAATGAACACAGCGAATGTTTCCTAAAT
CCTTGCCTTTCACTTCCTCCGATTACAGGAGAAAAAAAAAGTGCGTTCGCTACATACAAG
GTGAAGGCAGCTGCCTCAGCCCACCCTCTTCAGATGGAAGCTTAC
Restriction Sites Please inquire     
ACCN NM_001146284
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001146284.1, NP_001139756.1
RefSeq Size 3919 bp
RefSeq ORF 1368 bp
Locus ID 6934
UniProt ID Q9NQB0
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Acute myeloid leukemia, Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Melanogenesis, Pathways in cancer, Prostate cancer, Thyroid cancer, Wnt signaling pathway
Gene Summary This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
Transcript Variant: This variant (4) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift. The resulting protein (isoform 4) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...