PIGX (NM_017861) Human Untagged Clone
CAT#: SC327768
PIGX (untagged)-Human phosphatidylinositol glycan anchor biosynthesis class X (PIGX) transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PIG-X |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_017861, the custom clone sequence may differ by one or more nucleotides
CTGGCGGCTCGGGTGGCGGCGGTTCGGGCGGCCGCCTGGCTGCTCCTCGGGGCGGCGACCGGGCTCACGC GCGGGCCCGCCGCGGCCTTCACCGCCGCGCGCTCTGACGCCGGCATAAGGGCCATGTGTTCTGAAATTAT TTTGAGGCAAGAAGTTTTGAAAGATGGTTTCCACAGAGACCTTTTAATCAAAGTGAAGTTTGGGGAAAGC ATTGAGGACTTGCACACCTGCCGTCTCTTAATTAAACAGGACATTCCTGCAGGACTTTATGTGGATCCGT ATGAGTTGGCTTCATTACGAGAGAGAAACATAACAGAGGCAGTGATGGTTTCAGAAAATTTTGATATAGA GGCCCCTAACTATTTGTCCAAGGAGTCTGAAGTTCTCATTTATGCCAGACGAGATTCACAGTGCATTGAC TGTTTTCAAGCCTTTTTGCCTGTGCACTGCCGCTATCATCGGCCGCACAGTGAAGATGGAGAAGCCTCGA TTGTGGTCAATAACCCAGATTTGTTGATGTTTTGTGACCAAGAGTTCCCGATTTTGAAATGCTGGGCTCA CTCAGAAGTGGCAGCCCCTTGTGCTTTGGAGAATGAGGATATCTGCCAATGGAACAAGATGAAGTATAAA TCAGTATATAAGAATGTGATTCTACAAGTTCCAGTGGGACTGACTGTACATACCTCTCTAGTATGTTCTG TGACTCTGCTCATTACAATCCTGTGCTCTACATTGATCCTTGTAGCAGTTTTCAAATATGGCCATTTTTC CCTATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_017861 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_017861.3, NP_060331.3 |
RefSeq Size | 3052 bp |
RefSeq ORF | 777 bp |
Locus ID | 54965 |
UniProt ID | Q8TBF5 |
Protein Families | Transmembrane |
Protein Pathways | Glycosylphosphatidylinositol(GPI)-anchor biosynthesis, Metabolic pathways |
Gene Summary | This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205491 | PIGX (Myc-DDK-tagged)-Human phosphatidylinositol glycan anchor biosynthesis, class X (PIGX), transcript variant 2 |
CNY 2,400.00 |
|
RC205491L3 | Lenti ORF clone of Human phosphatidylinositol glycan anchor biosynthesis, class X (PIGX), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205491L4 | Lenti ORF clone of Human phosphatidylinositol glycan anchor biosynthesis, class X (PIGX), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG205491 | PIGX (tGFP-tagged) - Human phosphatidylinositol glycan anchor biosynthesis, class X (PIGX), transcript variant 2 |
CNY 4,000.00 |
|
SC100367 | PIGX (untagged)-Human phosphatidylinositol glycan anchor biosynthesis, class X (PIGX), transcript variant 2 |
CNY 2,400.00 |