United States
Germany
Japan
United Kingdom
China
Cholecystokinin (CCK) (NM_001174138) Human Untagged Clone
CAT＃: SC328187
CCK (untagged)-Human cholecystokinin (CCK) transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001174138, the custom clone sequence may differ by one or more nucleotides
ATGAACAGCGGCGTGTGCCTGTGCGTGCTGATGGCGGTACTGGCGGCTGGCGCCCTGACG CAGCCGGTGCCTCCCGCAGATCCCGCGGGCTCCGGGCTGCAGCGGGCAGAGGAGGCGCCC CGTAGGCAGCTGAGGGTATCGCAGAGAACGGATGGCGAGTCCCGAGCGCACCTGGGCGCC CTGCTGGCAAGATACATCCAGCAGGCCCGGAAAGCTCCTTCTGGACGAATGTCCATCGTT AAGAACCTGCAGAACCTGGACCCCAGCCACAGGATAAGTGACCGGGACTACATGGGCTGG ATGGATTTTGGCCGTCGCAGTGCCGAGGAGTATGAGTACCCCTCCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001174138 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001174138.1, NP_001167609.1 |
| RefSeq Size | 769 bp |
| RefSeq ORF | 348 bp |
| Locus ID | 885 |
| UniProt ID | P06307 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | This gene encodes a member of the gastrin/cholecystokinin family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the peptide hormones cholecystokinin-8, -12, -33, and others. The encoded peptides have been shown to regulate gastric acid secretion and food intake. A sulfated form of cholecystokinin-8 may modulate neuronal activity in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229549 | CCK (Myc-DDK-tagged)-Human cholecystokinin (CCK), transcript variant 2 |
CNY 1,200.00 |
|
| RC229549L3 | Lenti-ORF clone of CCK (Myc-DDK-tagged)-Human cholecystokinin (CCK), transcript variant 2 |
CNY 5,890.00 |
|
| RC229549L4 | Lenti-ORF clone of CCK (mGFP-tagged)-Human cholecystokinin (CCK), transcript variant 2 |
CNY 5,890.00 |
|
| RG229549 | CCK (tGFP-tagged) - Human cholecystokinin (CCK), transcript variant 2 |
CNY 4,370.00 |
