SFTPC (NM_001172410) Human Untagged Clone
CAT#: SC328310
SFTPC (untagged)-Human surfactant protein C (SFTPC) transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BRICD6; PSP-C; SFTP2; SMDP2; SP-C; SP5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001172410, the custom clone sequence may differ by one or more nucleotides
ATGGATGTGGGCAGCAAAGAGGTCCTGATGGAGAGCCCGCCGGACTACTCCGCAGCTCCC CGGGGCCGATTTGGCATTCCCTGCTGCCCAGTGCACCTGAAACGCCTTCTTATCGTGGTG GTGGTGGTGGTCCTCATCGTCGTGGTGATTGTGGGAGCCCTGCTCATGGGTCTCCACATG AGCCAGAAACACACGGAGATGGTTCTGGAGATGAGCATTGGGGCGCCGGAAGCCCAGCAA CGCCTGGCCCTGAGTGAGCACCTGGTTACCACTGCCACCTTCTCCATCGGCTCCACTGGC CTCGTGGTGTATGACTACCAGCAGCTGCTGATCGCCTACAAGCCAGCCCCTGGCACCTGC TGCTACATCATGAAGATAGCTCCAGAGAGCATCCCCAGTCTTGAGGCTCTCACTAGAAAA GTCCACAACTTCCAGATGGAATGCTCTCTGCAGGCCAAGCCCGCAGTGCCTACGTCTAAG CTGGGCCAGGCAGAGGGGCGAGATGCAGGCTCAGCACCCTCCGGAGGGGACCCGGCCTTC CTGGGCATGGCCGTGAGCACCCTGTGTGGCGAGGTGCCGCTCTACTACATCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001172410 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001172410.1, NP_001165881.1 |
RefSeq Size | 991 bp |
RefSeq ORF | 594 bp |
Locus ID | 6440 |
UniProt ID | P11686 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | This gene encodes the pulmonary-associated surfactant protein C (SPC), an extremely hydrophobic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 2, also called pulmonary alveolar proteinosis due to surfactant protein C deficiency, and are associated with interstitial lung disease in older infants, children, and adults. Alternatively spliced transcript variants encoding different protein isoforms have been identified.[provided by RefSeq, Feb 2010] Transcript Variant: This variant (2) lacks an internal segment in the 3' UTR, as compared to variant 1. Both variants 1 and 2 encode the same isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229672 | SFTPC (Myc-DDK-tagged)-Human surfactant protein C (SFTPC), transcript variant 2 |
CNY 3,990.00 |
|
RC229672L3 | Lenti-ORF clone of SFTPC (Myc-DDK-tagged)-Human surfactant protein C (SFTPC), transcript variant 2 |
CNY 5,890.00 |
|
RC229672L4 | Lenti-ORF clone of SFTPC (mGFP-tagged)-Human surfactant protein C (SFTPC), transcript variant 2 |
CNY 5,890.00 |
|
RG229672 | SFTPC (tGFP-tagged) - Human surfactant protein C (SFTPC), transcript variant 2 |
CNY 4,370.00 |