CD84 (NM_001184881) Human Untagged Clone

CAT#: SC328442

CD84 (untagged)-Human CD84 molecule (CD84) transcript variant 3



  "NM_001184881" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
CD84 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hCD84; LY9B; mCD84; SLAMF5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328442 representing NM_001184881.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTCAGCACCACCTATGGATCTTGCTCCTTTGCCTGCAAACCTGGCCGGAAGCAGCTGGAAAAGAC
TCAGAAATCTTCACAGTGAATGGGATTCTGGGAGAGTCAGTCACTTTCCCTGTAAATATCCAAGAACCA
CGGCAAGTTAAAATCATTGCTTGGACTTCTAAAACATCTGTTGCTTATGTAACACCAGGAGACTCAGAA
ACAGCACCCGTAGTTACTGTGACCCACAGAAATTATTATGAACGGATACATGCCTTAGGTCCGAACTAC
AATCTGGTCATTAGCGATCTGAGGATGGAAGACGCAGGAGACTACAAAGCAGACATAAATACACAGGCT
GATCCCTACACCACCACCAAGCGCTACAACCTGCAAATCTATCGTCGGCTTGGGAAACCAAAAATTACA
CAGAGTTTAATGGCATCTGTGAACAGCACCTGTAATGTCACACTGACATGCTCTGTAGAGAAAGAAGAA
AAGAATGTGACATACAATTGGAGTCCCCTGGGAGAAGAGGGTAATGTCCTTCAAATCTTCCAGACTCCT
GAGGACCAAGAGCTGACTTACACGTGTACAGCCCAGAACCCTGTCAGCAACAATTCTGACTCCATCTCT
GCCCGGCAGCTCTGTGCAGACATCGCAATGGGCTTCCGTACTCACCACACCGGGTTGCTGAGCGTGCTG
GCTATGTTCTTTCTGCTTGTTCTCATTCTGTCTTCAGTGTTTTTGTTCCGTTTGTTCAAGAGAAGACAA
GGTGCTTCCCTCCAAGGAAGAGCCAGTGAACACAGTTTATTCCGAAGTGCAGTTTGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001184881
Insert Size 819 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001184881.1
RefSeq Size 8147 bp
RefSeq ORF 819 bp
Locus ID 8832
UniProt ID Q9UIB8
Protein Families Druggable Genome, Transmembrane
MW 30.5 kDa
Gene Summary This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) lacks two alternate segments, one of which shifts the reading frame, compared to variant 1. The resulting protein (isoform 3) has a shorter and distinct C-terminus when it is compared to isoform 1. This variant has also been called CD84d. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...