SLC25A21 (NM_001171170) Human Untagged Clone

CAT#: SC328484

SLC25A21 (untagged)-Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier) member 21 (SLC25A21) nuclear gene encoding mitochondrial protein transcript variant 2



  "NM_001171170" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-SLC25A21 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MTDPS18; ODC; ODC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328484 representing NM_001171170.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCGCCAAGCCTGAAGTCAGCTTAGTGCGCGAGGCTTCTCGGCAGATCGTGGCCGGTGGTTCTGCA
GGTCTTGTAGAAATTTGCCTGATGCACCCCCTAGATGTGGTGAAAACCAGGTTTCAGATTCAGAGATGT
GCAACCGATCCAAACAGTTATAAAAGCTTGGTAGACAGCTTTCGAATGATTTTCCAAATGGAAGGGTTA
TTTGGTTTTTACAAGGGAATTCTGCCACCTATCTTGGCTGAAACCCCAAAAAGAGCAGTGAAGTTTTTC
ACCTTTGAGCAGTACAAGAAATTGCTGGGATATGTGTCACTGTCACCAGCATTGACATTCGCCATTGCT
GGATTGGGATCTGGACTAACAGAAGCCATTGTAGTTAACCCTTTTGAGGTAGTAAAAGTTGGCTTGCAA
GCAAATCGGAACACATTTGCAGAGCAACCATCCACTGTGGGTTATGCAAGACAAATCATTAAGAAGGAA
GGCTGGGGACTCCAGGGCCTCAACAAAGGATTAACTGCAACTTTGGGACGACATGGAGTTTTCAACATG
GTTTATTTTGGCTTCTACTACAATGTCAAAAACATGATTCCTGTCAATAAGGATCCAATCTTGGAGTTT
TGGAGAAAATTTGGGATTGGTCTTCTCTCGGGGACAATAGCCTCAGTCATTAACATCCCTTTTGATGTT
GCCAAAAGTAGGATTCAAGGGCCTCAACCAGTTCCTGGAGAGATCAAGTACAGAACCTGTTTTAAAACA
ATGGCAACAGTCTATCAGGAAGAAGGGATTTTAGCTTTGTACAAAGGCCTGCTTCCCAAGATTATGAGA
CTTGGACCAGGTGGTGCAGTGATGCTGCTGGTTTATGAATACACCTATTCATGGCTTCAAGAGAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001171170
Insert Size 897 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001171170.1
RefSeq Size 1770 bp
RefSeq ORF 897 bp
Locus ID 89874
UniProt ID Q9BQT8
MW 33.1 kDa
Gene Summary SLC25A21 is a homolog of the S. cerevisiae ODC proteins, mitochondrial carriers that transport C5-C7 oxodicarboxylates across inner mitochondrial membranes. One of the species transported by ODC is 2-oxoadipate, a common intermediate in the catabolism of lysine, tryptophan, and hydroxylysine in mammals. Within mitochondria, 2-oxoadipate is converted into acetyl-CoA.[supplied by OMIM, Apr 2004]
Transcript Variant: This variant (2) has a split 3' exon, as compared to variant 1. The resulting isoform (2) lacks the last aa, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...