BCAT1 (NM_001178092) Human Untagged Clone

CAT#: SC328529

BCAT1 (untagged)-Human branched chain amino-acid transaminase 1 cytosolic (BCAT1) transcript variant 3



  "NM_001178092" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
BCAT1 mouse monoclonal antibody, clone OTI3F5 (formerly 3F5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BCATC; BCT1; ECA39; MECA39; PNAS121; PP18
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328529 representing NM_001178092.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGCTAAAGACCTAATAGTCACACCAGCTACCATTTTAAAGGAAAAACCAGACCCCAATAATCTG
GTTTTTGGAACTGTGTTCACGGATCATATGCTGACGGTGGAGTGGTCCTCAGAGTTTGGATGGGAGAAA
CCTCATATCAAGCCTCTTCAGAACCTGTCATTGCACCCTGGCTCATCAGCTTTGCACTATGCAGTGGAA
GTATTTGACAAAGAAGAGCTCTTAGAGTGTATTCAACAGCTTGTGAAATTGGATCAAGAATGGGTCCCA
TATTCAACATCTGCTAGTCTGTATATTCGTCCTACATTCATTGGAACTGAGCCTTCTCTTGGAGTCAAG
AAGCCTACCAAAGCCCTGCTCTTTGTACTCTTGAGCCCAGTGGGACCTTATTTTTCAAGTGGAACCTTT
AATCCAGTGTCCCTGTGGGCCAATCCCAAGTATGTAAGAGCCTGGAAAGGTGGAACTGGGGACTGCAAG
ATGGGAGGGAATTACGGCTCATCTCTTTTTGCCCAATGTGAAGCAGTAGATAATGGGTGTCAGCAGGTC
CTGTGGCTCTATGGAGAGGACCATCAGATCACTGAAGTGGGAACTATGAATCTTTTTCTTTACTGGATA
AATGAAGATGGAGAAGAAGAACTGGCAACTCCTCCACTAGATGGCATCATTCTTCCAGGAGTGACAAGG
CGGTGCATTCTGGACCTGGCACATCAGTGGGGTGAATTTAAGGTGTCAGAGAGATACCTCACCATGGAT
GACTTGACAACAGCCCTGGAGGGGAACAGAGTGAGAGAGATGTTTGGCTCTGGTACAGCCTGTGTTGTT
TGCCCAGTTTCTGATATACTGTACAAAGGCGAGACAATACACATTCCAACTATGGAGAATGGTCCTAAG
CTGGCAAGCCGCATCTTGAGCAAATTAACTGATATCCAGTATGGAAGAGAAGAGAGCGACTGGACAATT
GTGCTATCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001178092
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001178092.1
RefSeq Size 9499 bp
RefSeq ORF 978 bp
Locus ID 586
UniProt ID P54687
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Pantothenate and CoA biosynthesis, Valine, leucine and isoleucine biosynthesis, Valine, leucine and isoleucine degradation
MW 36.3 kDa
Gene Summary This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
Transcript Variant: This variant (3) lacks two in-frame exons in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...