CARD8 (NM_001184903) Human Untagged Clone

CAT#: SC328624

CARD8 (untagged)-Human caspase recruitment domain family member 8 (CARD8) transcript variant 5



  "NM_001184903" in other vectors (4)

CNY 7,220.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-CARD8 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CARDINAL; DACAR; DAKAR; NDPP; NDPP1; TUCAN
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001184903, the custom clone sequence may differ by one or more nucleotides
ATGGAAAAAAAGGAGTGTCCAGAAAAGAGTAGCAGCAGTGAGGAAGAGCTGCCGAGACGG
GACAGTGGATCCAGTAGGAACATAGATGCATCCAAACTCATTAGACTACAAGGATCACGG
AAACTGTTGGTTGACAATAGCATACGGGAACTGCAATACACAAAAACTGGAATTTTTTTT
CAGGCTGAGGCCTGTGTGACAAATGATACGGTATACAGGGAGCTACCCTGTGTTTCTGAG
ACCCTTTGTGACATCTCACATTTTTTCCAAGAAGATGATGAGACAGAGGCAGAGCCATTA
TTGTTCCGTGCTGTTCCTGAGTGTCAACTATCTGGGGGGGACATTCCCAGTGTATCAGAA
GAGCAGGAATCTTCAGAGGGACAAGATTCAGGAGACATTTGCTCAGAAGAGAATCAAATA
GTTTCCTCTTATGCTTCTAAAGTCTGTTTTGAGATCGAAGAAGATTATAAAAATCGTCAG
TTTCTGGGGCCTGAAGGAAATGTGGATGTTGAGTTGATTGATAAGAGCACAAACAGATAC
AGCGTTTGGTTCCCCACTGCTGGCTGGTATCTGTGGTCAGCCACAGGCCTCGGCTTCCTG
GTAAGGGATGAGGTCACAGTGACGATTGCGTTTGGTTCCTGGAGTCAGCACCTGGCCCTG
GACCTGCAGCACCATGAACAGTGGCTGGTGGGCGGCCCCTTGTTTGATGTCACTGCAGAG
CCAGAGGAGGCTGTCGCCGAAATCCACCTCCCCCACTTCATCTCCCTCCAAGCAGGTGAG
GTGGACGTCTCCTGGTTTCTCGTTGCCCATTTTAAGAATGAAGGGATGGTCCTGGAGCAT
CCAGCCCGGGTGGAGCCTTTCTATGCTGTCCTGGAAAGCCCCAGCTTCTCTCTGATGGGC
ATCCTGCTGCGGATCGCCAGTGGGACTCGCCTCTCCATCCCCATCACTTCCAACACATTG
ATCTATTATCACCCCCACCCCGAAGATATTAAGTTCCACTTGTACCTTGTCCCCAGCGAC
GCCTTGCTAACAAAGGCGATAGATGATGAGGAAGATCGCTTCCATGGTGTGCGCCTGCAG
ACTTCGCCCCCAATGGAACCCCTGAACTTTGGTTCCAGTTATATTGTGTCTAATTCTGCT
AACCTGAAAGTAATGCCCAAGTGGATCTCCAGCTTGTAG
Restriction Sites Please inquire     
ACCN NM_001184903
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001184903.1, NP_001171832.1
RefSeq Size 5246 bp
RefSeq ORF 1179 bp
Locus ID 22900
UniProt ID Q9Y2G2
Protein Families Druggable Genome
Protein Pathways NOD-like receptor signaling pathway
Gene Summary The protein encoded by this gene belongs to the caspase recruitment domain (CARD)-containing family of proteins, which are involved in pathways leading to activation of caspases or nuclear factor kappa-B (NFKB). This protein may be a component of the inflammasome, a protein complex that plays a role in the activation of proinflammatory caspases. It is thought that this protein acts as an adaptor molecule that negatively regulates NFKB activation, CASP1-dependent IL1B secretion, and apoptosis. Polymorphisms in this gene may be associated with a susceptibility to rheumatoid arthritis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
Transcript Variant: This variant (5) differs in the 5' UTR and lacks an alternate exon in the 3' coding region, which results in a frameshift compared to variant 1. This results in a shorter protein (isoform c), compared to isoform a. Variants 4 and 5 encode the same isoform (c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...