Monocarboxylic acid transporter 1 (SLC16A1) (NM_001166496) Human Untagged Clone

CAT#: SC328820

SLC16A1 (untagged)-Human solute carrier family 16 member 1 (monocarboxylic acid transporter 1) (SLC16A1) transcript variant 2



  "NM_001166496" in other vectors (4)

CNY 5,592.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Anti-SLC16A1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HHF7; MCT; MCT1; MCT1D
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>SC328820 representing NM_001166496.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCACCAGCAGTTGGAGGTCCAGTTGGATACACCCCCCCAGATGGAGGCTGGGGCTGGGCAGTGGTA
ATTGGAGCTTTCATTTCCATCGGCTTCTCTTATGCATTTCCCAAATCAATTACTGTCTTCTTCAAAGAG
ATTGAAGGTATATTCCATGCCACCACCAGCGAAGTGTCATGGATATCCTCCATAATGTTGGCTGTCATG
TATGGTGGAGGTCCTATCAGCAGTATCCTGGTGAATAAATATGGAAGTCGTATAGTCATGATTGTTGGT
GGCTGCTTGTCAGGCTGTGGCTTGATTGCAGCTTCTTTCTGTAACACCGTACAGCAACTATACGTCTGT
ATTGGAGTCATTGGAGGTCTTGGGCTTGCCTTCAACTTGAATCCAGCTCTGACCATGATTGGCAAGTAT
TTCTACAAGAGGCGACCATTGGCCAACGGACTGGCCATGGCAGGCAGCCCTGTGTTCCTCTGTACTCTG
GCCCCCCTCAATCAGGTTTTCTTCGGTATCTTTGGATGGAGAGGAAGCTTTCTAATTCTTGGGGGCTTG
CTACTAAACTGCTGTGTTGCTGGAGCCCTCATGCGACCAATCGGGCCCAAGCCAACCAAGGCAGGGAAA
GATAAGTCTAAAGCATCCCTTGAGAAAGCTGGAAAATCTGGTGTGAAAAAAGATCTGCATGATGCAAAT
ACAGATCTTATTGGAAGACACCCTAAACAAGAGAAACGATCAGTCTTCCAAACAATTAATCAGTTCCTG
GACTTAACCCTATTCACCCACAGAGGCTTTTTGCTATACCTCTCTGGAAATGTGATCATGTTTTTTGGA
CTCTTTGCACCTTTGGTGTTTCTTAGTAGTTATGGGAAGAGTTAGCATTATTCTAGTGAGAAGTCTGCC
TTCCTTCTTTCCATTCTGGCTTTTGTTGACATGGTAGCCCGACCATCTATGGGACTTGTAGCCAACACA
AAGCCAATAAGACCTCGAATTCAGTATTTCTTTGCGGCTTCCGTTGTTGCAAATGGAGTGTGTCATATG
CTAGCACCTTTATCCACTACCTATGTTGGATTCTGTGTCTATGCGGGATTCTTTGGATTTGCCTTCGGG
TGGCTCAGCTCCGTATTGTTTGAAACATTGATGGACCTTGTTGGACCCCAGAGGTTCTCCAGCGCTGTG
GGATTGGTGACCATTGTGGAATGCTGTCCTGTCCTCCTGGGGCCACCACTTTTAGGTCGGCTCAATGAC
ATGTATGGAGACTACAAATACACATACTGGGCATGTGGCGTCGTCCTAATTATTTCAGGTATCTATCTC
TTCATTGGCATGGGCATCAATTATCGACTTTTGGCAAAAGAACAGAAAGCAAACGAGCAGAAAAAGGAA
AGTAAAGAGGAAGAGACCAGTATAGATGTTGCTGGGAAGCCAAATGAAGTTACCAAAGCAGCAGAATCT
CCGGACCAGAAAGACACAGAAGGAGGGCCCAAGGAGGAGGAAAGTCCAGTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001166496
Insert Size 1503 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001166496.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166496.1
RefSeq Size 4390 bp
RefSeq ORF 1503 bp
Locus ID 6566
UniProt ID P53985
Protein Families Transmembrane
MW 53.9 kDa
Gene Summary The protein encoded by this gene is a proton-linked monocarboxylate transporter that catalyzes the movement of many monocarboxylates, such as lactate and pyruvate, across the plasma membrane. Mutations in this gene are associated with erythrocyte lactate transporter defect. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Monocarboxylic acid transporter 1产品

Customer Reviews 
Loading...