RNF89 (TRIM6) (NM_001198645) Human Untagged Clone

CAT#: SC329467

TRIM6 (untagged) - Homo sapiens tripartite motif containing 6 (TRIM6), transcript variant 4



  "NM_001198645" in other vectors (2)

CNY 3,040.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal TRIM6 Antibody (N-term)
    • 400 ul

CNY 6,314.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RNF89
Vector pCMV6-Entry
Sequence Data
>SC329467 representing NM_001198645.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCCTGAGAGATGCAGGATCCAGACAGAGTTTAATCAGCTGCGAAATATCCTAGACAGAGTGGAG
CAACGGGAGCTGAAAAAGCTGGAACAGGAAGAGAAGAAGGGGCTACGAATTATAGAAGAGGCTGAGAAT
GATCTGGTCCACCAGACCCAGTCGCTGCGAGAGCTCATCTCGGATCTGGAGCGTCGATGTCAGGGGTCA
ACAATGGAGCTGCTGCAGGATGTGAGTGATGTCACAGAAAGGAGTGAGTTCTGGACCCTGAGGAAGCCA
GAAGCTCTCCCTACAAAGCTGAGAAGTATGTTCCGAGCCCCAGATCTGAAAAGGATGCTGCGAGTGTGT
AGAGAGCTGACAGATGTCCAAAGCTACTGGGTTGACGTGACCCTGAATCCACACACAGCTAATTTAAAT
CTTGTCCTGGCTAAAAACCGGAGACAAGTGAGGTTTGTGGGAGCTAAAGTATCTGGACCTTCCTGTCTG
GAAAAGCATTATGACTGTAGTGTCCTGGGCTCCCAGCACTTCTCCTCTGGTAAGCATTACTGGGAGGTA
GATGTGGCCAAGAAGACTGCCTGGATCCTGGGGGTATGCAGCAATTCACTGGGACCTACATTCTCTTTC
AACCATTTTGCTCAAAATCACAGTGCTTACTCCAGGTATCAGCCTCAGAGTGGATACTGGGTGATTGGG
TTACAGCATAACCATGAATATAGGGCCTATGAGGATTCTTCCCCTTCCCTGCTTCTCTCCATGACAGTG
CCCCCTCGCCGTGTTGGGGTTTTCTTAGATTATGAGGCTGGTACTGTCTCCTTTTATAATGTCACAAAC
CATGGCTTCCCCATCTACACTTTCTCTAAATATTACTTTCCCACTACTCTTTGTCCATATTTTAATCCT
TGCAACTGTGTAATTCCTATGACCCTGCGTCGTCCAAGCTCTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001198645
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001198645.1
RefSeq Size 2844 bp
RefSeq ORF 942 bp
Locus ID 117854
UniProt ID Q9C030
Protein Families Druggable Genome
MW 36.4 kDa
Gene Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. The protein localizes to the nucleus, but its specific function has not been identified. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from this gene into the downstream TRIM34 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010]
Transcript Variant: This variant (4) lacks two alternate exons in the 5' coding region, and uses a downstream AUG start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Both variants 3 and 4 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...